... to the DataGrid The MappingName property of the DataGridTableStyle is set to the DataSource The MappingName of each DataGridColumnStyle object must be associated with the name of a DataColumn ... abstract DataGridColumnStyle class It defines the attributes, display format, and behavior of cells in a DataGrid column representing a Boolean value At runtime, each cell in the column hosts a ... defines the attributes, display format, and behavior of cells in a DataGrid column At runtime, each cell in the column hosts a DataGridTextBox control The DataGridBoolColumn inherits from the abstract...
Ngày tải lên: 20/10/2013, 12:15
... unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by ... identified ISSs are S-AS ISSs, suggesting that the splicing regulatory mechanism associated with the sequence -independent S-AS repression is general in maintaining intact HBV transcripts The alignment ... proteins, a family of proteins containing one or two RNA-binding domains and a signature RS domain rich in Arg ⁄ Ser dipeptides, and splicing silencers usually recruit heterogeneous nuclear RNPs, a set...
Ngày tải lên: 28/03/2014, 23:20
Salesforce for logistics how TNT connect to their customers in a whole new way
... Safe Harbor Safe harbor statement under the Private Securities Litigation Reform Act of 1995: This presentation may contain forward-looking statements that involve risks, uncertainties, and assumptions ... 2015 QTR Demonstration A day in the life of an account manager … Connecting To Customers In A Whole New Way Our Journey Our Vision Add image Add image Add image Add image 2014 QTR 2015 QTR 2016 ... growth, earnings, revenues, or other financial items and any statements regarding strategies or plans of management for future operations, statements of belief, any statements concerning new, planned,...
Ngày tải lên: 07/03/2016, 18:22
Tài liệu Ways of Speaking in a Mexican Transnational Community docx
... caiva* no me daba recio, está de alta así Le digo, “yo me aguantaba así, pero solo que me escrituraran la huerta, pos enseguida, pa' aguantar las aguayabas si no.” And he had a bed of boards ... higher altitude Sierra to the west of the rancho is called the Meseta Tarasca, or Tarascan Tableland, for its many Indian villages This area, mountainous and cold in winter, was unattractive to Spanish ... have concluded that this traditional system is changing, and that tú is gaining ground over usted in many Spanish-speaking communities in Spain, Latin America, and the United States (Carricaburo,...
Ngày tải lên: 20/12/2013, 23:15
Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc
... Domain box and to automatically append the domain name to the user name If you type a domain name in User name, the domain name will be appended twice, which will cause problems with accessing ... For information about building Connection Manager profiles that automatically install certificates and certificate chains for the user, see Network Access Quarantine Control in Related Links ... Dialup in Key Name, and type in Value (as shown in the following figure), and click Apply 26 On the Advanced Customization page, click Connection Manager in Section Name, click HideDomain in...
Ngày tải lên: 27/01/2014, 15:20
Tài liệu Báo cáo khoa học: A second independent resistance mechanism to Bacillus sphaericus binary toxin targets its a-glucosidase receptor in Culex quinquefasciatus docx
... CGCCAGGGAGCTCACATGCCGTT), and three 3¢ oligonucleotides (primer 3, GAAAAGCTTCAGCTGGAA GTTGAACGGCAT; primer 4, AACAAGCTTCACGAA ATCTCCCAGGTCCAC; primer 7, AACAAGCTTGA AATCTCCCAGGTCCACGGT) were used To facilitate cloning ... proteins in larvae BBMF that bind specifically to Bin toxin As an initial approach to identify the molecular basis for the resistance of CqRL1 ⁄ 2362 larvae to the Bin toxin, we performed an assay ... Bacillus sphaericus: results of a pilot project in a large urban area of equatorial Africa Bull World Health Organ 71, 367–375 Kumar A, Sharma VP, Thavaselvam D, Sumodan PK, Kamat RH, Audi SS &...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
... ACCCGGGTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA: forward, GCGATAGAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB: forward, GCGATAGAATTC ... thus principally allowing covalent chromophore binding Forward primer: 5¢-CACTCGGTACTCCGCAGCGTTT CGCCGTGTCACATTGAATATTTGCACAATATGG -3¢; reverse primer: 5¢-CCATATTGTGCAAATATTCAA TGTGACACGGCGAAACGCTGCGGAGTACCGAG ... GCGATAGAATTC ATGACGAATTGCGATCGCGA and reverse, ACCCGG GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC CTCCTGCAATGT; cphBlong: forward, GCGATAGAA TTCATGTTGCAGTTAATTTATAACAATT; the reverse primer was identical to that...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo khoa học: "A comparison of clausal coordinate ellipsis in Estonian and German: Remarkably similar elision rules allow a language-independent ellipsis-generation module" pot
... dass Jan [sein Fahrrad]b reparierte ja et Peeter oma jalgratta puhastas und dass Peter sein Fahrrad putzte (20) Jan parandas oma uue jalgrattab Jan reparierte sein neues Fahrradb ja tema vennad ... Jan fachkundig sein Fahrrad reparierte ja [et Jan]f hoolikalt [oma jalgratta]f puhastas und [dass Jan]f eifrig [sein Fahrrad]f putzte (17) * Jan parandas oma jalgratta asjatundlikult * Jan reparierte ... ja [et Jan oma jalgratta]f hoolikalt puhastas und [dass Jan sein Fahrrad]f eifrig putzte and that Jan his bike diligently cleaned (16) *… et Jan asjatundlikult oma jalgratta parandas dass Jan...
Ngày tải lên: 31/03/2014, 20:20
– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx
... problem as needed by choosing b or d next, depending on whether you ANSWER SHEET 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 a a a a a a a a a a a a a a a a a a a a a a a a a a a b b ... 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 a a a a a a a a a a a a a a a a a a a a a a a a a a a b b b b b b b b b b b b b b b b b b b b b b b b b b b 212 c c c c c ... IAGONALS In all parallelograms, diagonals cut each other in two equal halves ■ In a rectangle, diagonals are the same length D C AC = DB A ■ B In a rhombus, diagonals intersect to form 90-degree angles...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf
... treated and untreated OvCa cells decrease CCL25 also induced a gradual increase in Akt phosphorylation and 10 minutes after treatment Wortmannin treatment abrogated this increase, but CCL25treated ... survival by phosphorylating and inactivating proapoptotic factors, such as FKHR and GSK-3β [7] FKHR is a transcription factor that transactivates the expression of death-activating proteins, such as ... CCR9 signalling and survival mechanisms are independent of FAK activity Conflicting studies demonstrated cisplatin activates Akt in several cancer cell lines, which leads to cisplatin resistance...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: " Circular polarization in a non-magnetic resonant tunneling device" pdf
... the QW and contact layers split into spin-up and spin-down Zeeman states and the optical recombination can occur with well-defined selection rules giving information about the spin polarization ... FE PL intensity decreases and a new lower energy PL line abruptly appears and gain intensity at expense of the exciton PL This abrupt transfer was explained by a phenomenological dynamical model ... (perpendicular to the 2DEG plane) for integer and fractional filling factors (ν < 2) on high quality modulation doped GaAs/AlGaAs heterojunction (HJ) [16-19] Actually, it was observed that for filling factors...
Ngày tải lên: 21/06/2014, 06:20
Creating an Inclusive Environment: A Handbook for the Inclusion of People with Disabilities in National and Community Service Programs ppt
... tử ba minh h a ví dụ sau Sử dụng toán tử bao using System; class Tester { public static int Main() { int value1; int value2; int maxValue; value1 = 10; value2 = 20; maxValue = value1 > value2 ... dt.Month; Date = dt.Day; Hour = dt.Hour; Minute = dt.Minute; Second = dt.Second; } private int Year; private int Month; private int Date; private int Hour; private int Minute; private int Second; ... Tester { static int Main() { int valueOne = 10; int valueTwo; valueTwo = valueOne++; Console.WriteLine("Thuc hien tang sau: {0}, {1}", valueOne, valueTwo); valueOne = 20; valueTwo = ++valueOne;...
Ngày tải lên: 28/06/2014, 23:20
Báo cáo toán học: "On the number of independent sets in a tree" pdf
... The number of matchings in a tree In this section, we turn to the number of matchings in a graph This is also known as the Hosoya index, or the Z-index in mathematical chemistry For a rooted tree ... operation with (−1, 1), we have (1, a) ∈ B for all a Moreover, (0, 1) ⊙ (1, a) = (0, a) is in B for all a as well Suppose for a fixed k < m, we have {(i, a) : i k − 1, a} ⊂ B In particular, (i, ... electronic journal of combinatorics 17 (2010), #N18 Consider (T, r) obtained from T1 by joining a new vertex r to r1 Then ϕ(T, r) = (b, b + a) Hence, µ (a, b) ∈ D Inductively adding a leaf to the root,...
Ngày tải lên: 08/08/2014, 11:20
báo cáo khoa học: "CCR9-CCL25 interactions promote cisplatin resistance in breast cancer cell through Akt activation in a PI3K-dependent and FAK-independent fashion" pptx
... participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... adenocarcinoma of the pancreas that developed extensive intratumoral calcification European Journal of Radiology Extra 2009, 71(2):e65-e69 Aydemir S, Savranlar A, Engin H, Cihan A, Ustundag Y, ... Malet A, Saigi E, Rey M: Gastrointestinal stromal tumors Abdom Imaging 2006, 31(4):387-399 Chamadol N, Laopaiboon V, Promsorn J, Bhudhisawasd V, Pagkhem A, Pairojkul C: Gastrointestinal stromal tumor:...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps
... MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between a paralogue ... MICA-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: ... within a second independent French Caucasian family cohort and a case-control cohort of German Caucasian origin Association analysis within the second and combined first and second French family...
Ngày tải lên: 09/08/2014, 14:20
Báo cáo y học: "Uric acid is a strong independent predictor of renal dysfunction in patients with rheumatoid arthritis" docx
... participated in data acquisition, provided technical assistance and assisted in analysis and interpretation of data TT, HJ and IA participated in data acquisition PN performed the statistical ... statistical analysis and assisted in manuscript preparation KMJD and RK participated in data acquisition and assisted in manuscript preparation GDK conceived the idea of the study and Available online ... Kubo M, Kiyohara Y, Kato I, Iwamoto H, Nakayama K, Hirakata H, Fujishima M: Effect of hyperinsulinemia on renal function in a general Japanese population: the Hisayama study Kidney Int 1999, 55:2450-2456...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Delayed intracardial shunting and hypoxemia after massive pulmonary embolism in a patient with a biventricular assist device" pdf
... has an incidence up to 27% in normal healthy adults as well as in adult cardiac surgical patients [8,9] If left ventricular assist device (LVAD) is activated, left atrial unloading leads to a ... IA: Profound hypoxemia resulting from shunting across an inadvertent atrial septal tear after left ventricular assist device placement Anesth Analg 2004, 98(4):937-940 Kavarana MN, Rahman FA, ... Therefore, intraoperative transesophageal echocardiography with colour Doppler imaging and contrast with agitated saline is highly recommended before cardiopulmonary bypass and after LVAD activation...
Ngày tải lên: 10/08/2014, 09:22
báo cáo khoa học: " Ovarian cryopreservation after laparoscopic ovariectomy using the Endo-GIA stapling device and LAPRO-clip absorbable ligating clip in a woman: a case report" ppt
... some data suggest that bipolar electrocoagulation of the ovarian parenchyma during laparoscopic ovarian cystectomy adversely affects ovarian function [5,6] These data show possible impact of ... electrocoagulatory ovarian tissue damage on the outcome of ovarian tissue harvesting and reimplantation Further studies should assess ovarian tissue damage and the results of ovarian cryopreservation ... contributions Each author participated sufficiently in the work IR, XD and MG performed surgical procedure and analyzed and interpreted the patient data regarding the surgical management JL and AM performed...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo khoa hoc:" A simple way to distinguish bed clothing contamination in a whole body bone scan: a case report" ppsx
... to eliminate or reduce the uptake of radioactivity absorbed into the body, and cleaning and decontaminating dry and wet surface, equipment and clothing Figure ing contamination activity at the ... areas, typically the knees and forearms, contaminating a protective cloth or table, which may result in confounded and misinterpreted final images [2] Some reports also indicate adverse working ... her bed clothing, the abnormal tracer uptake disappeared Case-2 A 45 year old woman, with a history of adenocarcinoma of the right breast and a mastectomy performed two years ago, was referred...
Ngày tải lên: 11/08/2014, 10:22
báo cáo khoa học: " Tic20 forms a channel independent of Tic110 in chloroplasts" pot
... primer forward reverse PsTic20 CCTAGATGGTCTCTCATAGC GCAGTAGTCCAGAAATGC PsTic110 CAAGGAAACTGCTCTGTC CTCCTTTGATGTCCTCTACC Ps18SrRNA CCAGGTCCAGACATAGTAAG GAGGGTTACCTCCACATAG CTTAGTCGTACGGAATCTGG AtTic20-I ... AtTic20-I AGGTTATAGGGACCGTTAGC qRT-PCR AtTic20-IV CTATGTCCAACCTTTTCTCG CTGTTTCAAGAAGCATACCC RNA isolation, cDNA preparation, qRT-PCR and data analysis were performed essentially as described in [44] ... PsTic20 [GenBank: AF095285.1], PsTic110 [GenBank: Z68506.1], AtTic110 CTAAAGGAGTGGTCTTGTCG GCAGAAGATAATGCTCCATC At18SrRNA AACTCGACGGATCGCATGG ACTACCTCCCCGTGTCAGG Gene-specific primers generated for...
Ngày tải lên: 11/08/2014, 11:21