creating altering and dropping databases with t sql

... not UPDATE STATISTICS by itself but can turn on the automatic UPDATE STATISTICS procedure This update is performed by the task that detected that the statistics needed to be updated The update ... packages that export the data from the database and place the data into tab-delimited text files Create an application that uses SQL_ DMO to extract the data from the database and transform the data ... constraint between the two tables, and rows must be deleted from both tables A simple DELETE statement cannot accomplish this Two DELETE statements must be used; first one DELETE statement on the Parts...

Ngày tải lên: 04/11/2013, 16:15

... the total be correct It may not matter in the report which account the money was in at the instant the report was run, but it is important that the report doesn t see the in-between point, where ... of storing and inspecting data It’s easy to sort the data in different ways, and see the features and patterns in the data just by looking at it Unfortunately, people often mistake a tool that ... copyright statement that says, “Permission to use, copy, modify, and distribute this software and its documentation for any purpose, without fee, and without a written agreement is hereby granted,...

Ngày tải lên: 09/08/2014, 14:20

... with these commands: pg_ctl start pg_ctl stop pg_ctl restart Connecting to the Database Now you can check that the database is functioning by trying to connect to it The psql utility is used to ... quantity) quantity) quantity) quantity) Stock table INSERT INSERT INSERT INSERT INSERT INSERT INSERT INTO stock(item_id, quantity) VALUES(1,12); INTO stock(item_id, quantity) VALUES(2,2); INTO stock(item_id, ... creating and populating tables In this chapter, we will take a slightly more formal look at SQL, starting with the SELECT statement In fact, this whole chapter is devoted to the SELECT statement...

Ngày tải lên: 09/08/2014, 14:20

... connect to a special database included with all PostgreSQL installations, template1 Once connected to template1, we can create a database, and then either quit and restart psql or use the \c internal ... PostgreSQL using the INSERT statement We can add data to only a single table at any one time, and generally we that one row at a time Using Basic INSERT Statements The basic SQL INSERT statement ... users with full permissions on the database, the prompt is replaced with =# psql commands are of two different types: • SQL commands: We can issue any SQL statement that PostgreSQL supports to psql,...

Ngày tải lên: 09/08/2014, 14:20

... (mystring::text ''::text) test=> Now let’s try changing some constraints and other rules: test=> ALTER TABLE ttconst ALTER TABLE test=> ALTER TABLE ttconst NOTICE: ALTER TABLE / ADD const" ALTER TABLE ... TABLE testtype; DROP TABLE test=> CREATE TABLE testtype ( test(> asmallint smallint, test(> anint int, test(> afloat float(2), test(> areal real, test(> anumeric numeric(5,2) test(> ); CREATE TABLE ... First, we need to drop our testtype table, and then we can re-create it with some different column types: test=> DROP TABLE testtype; DROP TABLE test=> test=> CREATE TABLE testtype ( test(> singlechar...

Ngày tải lên: 09/08/2014, 14:20

... transactions that affect multiple tables First, ensure both tables are empty, and then insert a row into the first table: test=> DELETE test=> DELETE test=> INSERT DELETE FROM ttest1; DELETE FROM ttest2; ... 9-3, we start by executing a BEGIN statement, which starts our transaction, and then execute two SQL statements We then create a savepoint called parta, and execute a third SQL statement We then ... statements to occur in a transaction, with the transaction starting automatically on the first SQL statement and continuing until a COMMIT or ROLLBACK is encountered Thus, standard SQL does not define...

Ngày tải lên: 09/08/2014, 14:20

... execute By default, this is set to 0, which disables this feature stats_start_collector If set to true, PostgreSQL collects internal statistics, usable by the pg_stat_activity and other statistics ... command defaults to creating tables with OIDs By default, this is set to true at the time of writing This option may be required in the future should PostgreSQL default to not creating OIDs but ... initdb Utility to initialize the database system pg_ctl PostgreSQL control—start, stop, and restart the server createuser Utility to create a database user dropuser Utility to delete a database user...

Ngày tải lên: 09/08/2014, 14:20

... hierarchy We would insert rows like this: test=> test=> test=> test=> test=> test=> test=> INSERT INSERT INSERT INSERT INSERT INSERT INSERT INTO INTO INTO INTO INTO INTO INTO person(emp_id, person(emp_id, ... with SQL statements that have not returned any data Now it is time to consider how to deal with data returned by calls to PQexec, the results of SELECT statements When we perform a SELECT with ... query that requires the server to no work at all PGRES_COMMAND_OK Success; command does not return data This status means that the SQL executed correctly, and the statement was of the type that does...

Ngày tải lên: 09/08/2014, 14:20

... connection attributes in your connection statement One important connection attribute is AutoCommit Setting this to causes DBI to treat each operation as a single transaction; setting it to gives ... in the next section Working with Result Sets After a statement has been executed, the statement handle can be used to extract any results that have been returned The return value of the execute ... connection pg_options() Returns the options associated with the current connection (except for the database name) pg_port() Returns the port number of the current connection pg_tty() Returns the TTY...

Ngày tải lên: 09/08/2014, 14:20

... statements that aren t executed many times, as they can simplify construction of the SQL statement They are also an important step on the way to prepared statements To create a SQL statement that ... next result is a ResultSet object The executeUpdate method executes SQL statements associated with prepared statements that don t return result sets, such as INSERT and UPDATE: public int executeUpdate() ... stmt.setString(6,"NT2 1AQ"); stmt.setString(7,"023 9876"); stmt.executeUpdate(); stmt.clearParameters(); stmt.setString(1,"Mr"); stmt.setString(2,"Barney"); stmt.setString(3,"Rubble"); stmt.setString(4,"22...

Ngày tải lên: 09/08/2014, 14:20

... important to understand that the import and export functions lo_import and lo_export are executed by the back-end database server, not by psql Any client application using SQL statements can use these ... object manipulation must take place within a SQL transaction—between BEGIN and COMMIT or END statements By default, psql executes each SQL statement in its own transaction, so this is not a problem, ... HTML table output mode, 118 setting HTML table tag options, 119 setting table output option, 120 setting table title for output, 119 table constraints, 222–223 table definitions, 377 table name...

Ngày tải lên: 09/08/2014, 14:20

... stored With a varchar data type on a table column, the data is stored physically in the row with the rest of the data With a text data type, the data is stored separately from the actual row and ... how the INSERT, UPDATE, and DELETE statements interact with the relational database engine and transaction log to lock and modify data rows with guaranteed consistency You will not only learn to ... language and data management systems, and then continue with the SQL Server product fundamentals This first section teaches the essentials of the SQL Server product architecture and relational database...

Ngày tải lên: 05/05/2014, 13:09

... Vi t Stored Procedure T n thông tin Stored Procedure t o chứa SysObjects table phần text chứa SysComments table Vì Stored Procedure xem object nên ta dùng lệnh CREATE, ALTER, DROP để t o mới, thay ... smallint BEGIN TRANSACTION If not Exists(SELECT CustomerID FROM Customers WHERE [Name]=@CustomerName) This is a new customer Insert this customer to the database BEGIN SET @CustomerID= (SELECT Max(CustomerID) ... VALUES(@OrderID,@ProductName,@CustomerID) SELECT COMMIT END END Print @Result Return insert it now INTO [Orders] @Result=0 TRANSACTION Ðể t o stored procedure ta dùng lệnh CREATE PROCEDURE theo sau t n (nếu temporary stored...

Ngày tải lên: 25/08/2012, 09:00

... vào commit transaction với k t trả =0 T ơng t người customer t n (sau chữ else đầu tiên) ta việc insert order giống Trong trường hợp kể ta in k t return Ví dụ mang t nh học hỏi thực t database ... smallint BEGIN TRANSACTION If not Exists(SELECT CustomerID FROM Customers WHERE [Name]=@CustomerName) This is a new customer Insert this customer to the database BEGIN SET @CustomerID= (SELECT Max(CustomerID) ... (nếu temporary stored procedure thêm dấu # trước t n procedure Nếu muốn encrypt dùng WITH ENCRYPTION trước chữ AS) input ouput parameters Nếu output thêm keyword OUTPUT đằng sau parameter Ta cho...

Ngày tải lên: 06/10/2013, 17:20

... the "Technique" section, this code then assigns the routine to the Text property of the Label called lblSQLString It then creates a data adapter using the string and fills the dtResults DataTable ... the controls listed in Table 6.2 and seen in Figure 6.3 with the following properties set Table 6.2 Control Property Settings for This How-To Object Property Setting Label Text SQL Statement Label ... How-To calls the DateDiff() function As with Visual Basic's DateDiff() function, this function takes two dates, and based on the interval requested, it returns the difference between the two To...

Ngày tải lên: 14/12/2013, 20:16

... TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third ... encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen ... properties with the staphylococcal enterotoxins SEB and SEC than with other streptococcal SAgs [19] Cellular proliferation studies show disagreement about which TCR bearing T- cell subsets are expanded...

Ngày tải lên: 07/03/2014, 16:20

... external circuit consists of electrons moving out of the negative terminal of the battery and into the positive terminal of the battery Hole flow, on the other hand, only exists within the material ... crystal that has been thermally agitated we have two types of current movement; the free electron movement and the hole movement The movement of holes can be best illustrated with the arrangement ... applications, the Zener, Schottky, tunnel, and varactor diodes, and optoelectronics devices Chapters and are devoted to bipolar junction transistors and FETs respectively, and many examples with detailed...

Ngày tải lên: 08/04/2014, 10:08

... ∞ < t < +∞ To this, it is convenient to divide the time interval into two parts, – ∞ < t < , and < t < ∞ For the time interval – ∞ < t < , the switch is open and therefore, the output voltage ... property states that e ∞ t ∫– ∞ t e t δ ( t – ) dt = t e t= 2 = 4e –2 ∞ ∫–∞ f ( t )δ ( t – α ) dt = f ( α ) Thus, = 0.54 f We recall that the sampling property for the doublet states that f ( t ... )δ ( t ) = f ( )δ ( t ) • The sifting property of the delta function states that ∞ ∫–∞ f ( t )δ ( t – α ) dt = f(α) • The sampling property of the doublet function δ' ( t ) states that f ( t )δ'...

Ngày tải lên: 08/04/2014, 10:28

... pulsed with class I epitope of hTERT, with or without class II epitopes This strategy has been used previously with melanoma-related antigen class I peptides to compare the activity of immature and ... taking systemic steroids, nor did they have any medical contraindication to enrolment Patients Ten patients (6 with prostate cancer, with malignant melanoma, with breast cancer and with lung cancer) ... Results are represented as mean (SD) Statistically significant SCC-4 cytotoxicity was observed with DCT and DCTI re-stimulated PBMCs compared with PBMCs restimulated without the class I peptides...

Ngày tải lên: 18/06/2014, 15:20

... batch that alters the table by adding a column and then updates the same column in the table c Sam cannot create a batch that uses the ALTER TABLE and UPDATE statements together d Sam cannot ... without the knowledge of T- SQL statements is partially true While it is technically possible to create a stored procedure without using T- SQL, it is not possible to access any data without using T- SQL ... =’Accts’ UPDATE EmpDetails SET Department=’Accounts’ UPDATE EmpDetails SET Department=’Accounts’ FOR Department =’Accts’ UPDATE TABLE EmpDetails SET Department=’Accounts’ WHERE Department =’Accts’...

Ngày tải lên: 27/06/2014, 12:20