creating a simple collision detection system

Tài liệu Creating a Simple ASP.NET Web Application Using VS .NET pptx

Tài liệu Creating a Simple ASP.NET Web Application Using VS .NET pptx

Ngày tải lên : 21/01/2014, 07:20
... the Page_Load() method For example, if you wanted to access a database, you would open the database connection in the Page_Load() method The OnInit() and InitializeComponent() methods are placed ... AutoEventWireUp attribute indicates whether the ASP.NET framework automatically calls the Page_Init() and Page_Load() event handler methods These methods are defined in the WebForm1.aspx.cs; you'll learn ... thou her maid art far more fair than she"; } } } As you can see, the WebForm1 class is derived from the System. Web.UI.Page class In fact, when you run your form, NET actually creates an object...
  • 8
  • 379
  • 0
Tài liệu Creating a Simple Shopping Cart Application ppt

Tài liệu Creating a Simple Shopping Cart Application ppt

Ngày tải lên : 21/01/2014, 07:20
... DataView(Cart); 25 ShoppingCart.DataSource = CartView; 26 ShoppingCart.DataBind(); 27 28 if (!this.IsPostBack) 29 { 30 // populate dataSet11 with the rows from the Products DataTable 31 sqlDataAdapter1.Fill(dataSet11, ... creates a DataTable to store the shopping cart, and that this DataTable is stored in the Session object: private void Page_Load(object sender, System. EventArgs e) { 10 // Put user code to initialize ... want to modify the code yourself: Select View ➣ Code, or press F7 on your keyboard to view the code Add a DataTable object named Cart and a DataView object named CartView to the WebForm1 class,...
  • 6
  • 281
  • 1
Báo cáo y học: "Risk assessment in the first fifteen minutes: a prospective cohort study of a simple physiological scoring system in the emergency department" ppsx

Báo cáo y học: "Risk assessment in the first fifteen minutes: a prospective cohort study of a simple physiological scoring system in the emergency department" ppsx

Ngày tải lên : 14/08/2014, 07:21
... score can help to select patients who can be treated as outpatients should be studied separately Our hospital serves as a primary care centre for a large urban area as well as a tertiary care centre ... established MET criteria might aid in early recognition of patients at risk of an unfavourable outcome Materials and methods Setting Table Vital Sign Scoring parameters Airway • threatened airway: ... ED patients TM and DB performed the statistical analysis The manuscript was drafted by TM, assisted by JW and JT All authors read and revised the manuscript drafts and approved the final manuscript...
  • 9
  • 416
  • 0
Sprite: A Simple, Cheat-Proof, Credit-Based System for Mobile Ad-Hoc Networks potx

Sprite: A Simple, Cheat-Proof, Credit-Based System for Mobile Ad-Hoc Networks potx

Ngày tải lên : 15/03/2014, 04:20
... Discussion and extension The above approach is secure for route discovery Its security can be argued in a similar way as the unicast case As route-discovery broadcast can be viewed as a special case ... own packets Our analysis shows that the first rule is actually optimal to achieve their given goals Although this new scheme is simple and elegant, it still requires a tamperproof hardware at each ... send a message and that of an intermediate node to forward a message, respectively We observe that RSA has a much smaller forwarding overhead Thus, if reducing forwarding overhead is the major...
  • 11
  • 916
  • 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Ngày tải lên : 16/03/2014, 01:20
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
  • 9
  • 444
  • 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Ngày tải lên : 17/03/2014, 10:20
... Ishihara, K., Yasuda, K & Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , ... 3465 Activation of HSF by SA and accumulation of Hsp10 5a and Hsp70 To examine whether SA enhances heat shock promoter activity by activating HSF, a gel mobility shift assay using 32 P-labelled ... cells SA has a potent anti-inflammatory effect mediated by suppression of the production of inflammatory mediators by inhibition of cyclooxygenase and nuclear factor-kappa B activation [9,10] In addition...
  • 8
  • 470
  • 0
Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf

Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf

Ngày tải lên : 23/03/2014, 04:21
... used human monoamine oxidase B, a membrane-bound flavoenzyme that catalyses the oxidation of arylalkylamine neurotransmitters and bears a FAD cofactor covalently attached to a cysteine residue [21] ... spectropolarimeter (Jasco Europe, Cremella, Italy) equipped with a Neslab RT-11 programmable water bath (Thermo Fisher Scientific, Waltham, MA, USA) and a mm path-length cuvette Thermal denaturation was ... biochemical and structural characterisation (Table 1) Their purity was checked by SDS–PAGE analysis, and protein concentration was evaluated by measuring the UV ⁄ vis absorbance of the bound flavin...
  • 8
  • 464
  • 0
Báo cáo khoa học: " A simple and rapid method for detection of Goose Parvovirus in the field by loop-mediated isothermal amplification" pps

Báo cáo khoa học: " A simple and rapid method for detection of Goose Parvovirus in the field by loop-mediated isothermal amplification" pps

Ngày tải lên : 12/08/2014, 04:21
... 5’-ggtttggcagaacagggata-3’ B3 FIP Backward outer Forward inner (F1c +F2) 1406 1425 20-nt 40-mer(F1c:22-nt, F2:18-nt) 5’-gcccgtagagtactgggtta -3’ 5’-ggccaaatcctccgagattcgg-cagggacctattggggca -3’ BIP Backward ... both laboratory and field settings Materials and methods Goslings, tissues, virus, DNA, and standard plasmid DNA templates preparation Goslings, tissues, virus, and standard plasmid DNA templates ... Escherichia coli (O78) (Key Laboratory of Animal Diseases and Human Health of Sichuan Province) FQ-PCR was carried out as control assay Sensitivity of the LAMP assay The detection limits of the assay...
  • 7
  • 382
  • 0
Báo cáo y học: " The Simple Triage Scoring System (STSS) successfully predicts mortality and critical care resource utilization in H1N1 pandemic flu: a retrospective analysis" doc

Báo cáo y học: " The Simple Triage Scoring System (STSS) successfully predicts mortality and critical care resource utilization in H1N1 pandemic flu: a retrospective analysis" doc

Ngày tải lên : 14/08/2014, 07:21
... vital signs and patient characteristics that are readily available at initial presentation, was proposed in 2007 by Talmor and colleagues [14] as a potential alternative tool in predicting death ... Bentley A, Bright J, Walter D: Clinical review: mass casualty triage - pandemic influenza and critical care Crit Care 2007, 11:212-212 19 Department of Health: Pandemic flu: managing demand and capacity ... prioritize admission to critical care beds After an exhaustive literature search, the Sepsis-related Organ Failure Assessment (SOFA) score [7] was suggested as part of a staged triage and treatment...
  • 9
  • 309
  • 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

Ngày tải lên : 12/09/2012, 15:05
... separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database system can ... the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved ... simulates the actions of a cleaner until a threshold number of clean segments is available again In each run the simulator was allowed to run until the write cost stabilized and all coldstart variance...
  • 15
  • 1.4K
  • 0
A simple introduction to working with LVM

A simple introduction to working with LVM

Ngày tải lên : 18/09/2012, 10:12
... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... be able to see it included in the output of vgscan: root@lappy:~# vgscan Reading all physical volumes This may take a while Found volume group "skx-vol" using metadata type lvm2 Now that we have...
  • 7
  • 674
  • 0
Báo cáo y học: "Surgical Treatment of Depressed Scar: A Simple Technique"

Báo cáo y học: "Surgical Treatment of Depressed Scar: A Simple Technique"

Ngày tải lên : 25/10/2012, 11:00
... Monocril 2-3/0 are made with a large needle and are placed close together so that a wide aversion is achieved at the margins of the scar and a deep wound closure is obtained by adhering to the ... recreate again: this relapse could promote the formation of a layer of reactive collagen in the region below the treated area We therefore believe that this technique can be utilized as a simple and ... patient All the authors read and approved the final manuscript CONSENT STATEMENT Written informed consent was obtained from the patient for publication of this case report and accompanying images...
  • 3
  • 449
  • 0
A simple calculator

A simple calculator

Ngày tải lên : 25/04/2013, 08:07
... themselves char ∗strs [10]; – an array of char arrays (or strings) Pointer array example • Have an array int arr [100]; that contains some numbers • Want to have a sorted version of the array, but ... Pointer arrays • Pointer array – array of pointers – an array of pointers to int’s char ∗arr [10]; – an array of pointers to char’s int ∗arr [20]; • Pointers in array can point to arrays themselves ... Multidimensional arrays are rectangular; pointer arrays can be arbitrary shaped 13 6.087 Lecture – January 20, 2010 Review More about Pointers Pointers to Pointers Pointer Arrays Multidimensional Arrays Data...
  • 44
  • 301
  • 0
Luận văn HỆ THỐNG PHÁT HIỆN XÂM NHẬP (IDS-Intrusion Detection System)

Luận văn HỆ THỐNG PHÁT HIỆN XÂM NHẬP (IDS-Intrusion Detection System)

Ngày tải lên : 13/08/2013, 10:51
... cho Snort: Hai database cần mysql archive để cập nhập lưu trữ liệu Snort Khởi tạo lệnh sau: Mysql>create database mysnort; Mysql>create database archive; Để xem lại databases v a tạo ta dùng lệnh: ... IP header gói - Header lớp transport Header gồm: TCP, UDP, header lớp transport khác Nó làm việc ICMP header - Header lớp application Nó gồm có: DNS header, FTP header, SNMP header, SMTP header ... mật hay kh a đối xứng (Secret key Cryptography) mã h a kh a công khai (Public key Cryptography) Mã h a kh a công khai sử dụng kh a có độ dài lớn, thuật toán phức tạp, có độ an toàn cao thời gian...
  • 65
  • 1K
  • 10
Creating a dataview using visual studio  NET

Creating a dataview using visual studio NET

Ngày tải lên : 20/08/2013, 16:48
... 14 // 15 InitializeComponent(); 16 17 // call the Fill() method of sqlDataAdapter1 18 // to populate dataSet11 with a DataTable named 19 // Customers 20 sqlDataAdapter1.Fill(dataSet11, "Customers"); ... data stored in dataView1 to dataGrid1 and allows dataGrid1 to access any data stored in dataView1 Figure 13.2: Setting the Properties of dataGrid1 Select View ➣ Code and set the Form1() ... "Customers"); 21 } Compile and run your form by pressing Ctrl+F5 Figure 13.3 shows the running form Notice that the information in the form comes from the DataView you created Figure 13.3: The running...
  • 3
  • 437
  • 1
DETOXIFICATION OF TRICHLOROETHYLENE (TCE) USING SOLAR LIGHT/TiO2 IN A UV CONCENTRATING RADIATION SYSTEM

DETOXIFICATION OF TRICHLOROETHYLENE (TCE) USING SOLAR LIGHT/TiO2 IN A UV CONCENTRATING RADIATION SYSTEM

Ngày tải lên : 05/09/2013, 08:40
... TCE degradation were examined MATERIALS AND METHODS TCE (99+%) was obtained from Aldrich Chemical Co, and the TiO2 used was Degussa P-25, which was mostly anatase and had a BET surface area of 50-m2/g ... GC/MS analysis; and were dichoacetic acid (DCAA), the methyl esters of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA), respectively They were confirmed by comparison of mass spectra and ... one-pass solar detoxification system (Pacheco et al., 1993) and contaminated surface water can be treated in a UV concentrating radiation System (Yves et al., 1996) In this process, major toxic...
  • 6
  • 392
  • 0
PERFORMANCE OF A COMBINED CONSTRUCTED WETLAND SYSTEM FOR TREATING VILLAGE SEWAGE IN LAKE DIANCHI VALLEY

PERFORMANCE OF A COMBINED CONSTRUCTED WETLAND SYSTEM FOR TREATING VILLAGE SEWAGE IN LAKE DIANCHI VALLEY

Ngày tải lên : 05/09/2013, 08:40
... the pollutants concentration was low in the rain season (from May to October) The data from the local weather station showed that the average annual rainfall and evaporation was 802mm and 2093mm, ... order to make full use of the land advantage to strengthen ecological and scenical effect of ecological system The area was 2000 m2 and hydraulic loading rate was 4cm/d in the free-surface constructed ... domestic wastewater in Lake Dianchi Valley., Proceedings of Asian waterqual’2003, IWA Asia-Pacific Regional conference, Abstract on pp 70, Paper on CD-ROM, Bangkok Liu, C.X., Hu, H.-Y., Huang, X.,...
  • 8
  • 450
  • 0
Spatial moment analysis of colloid facilitated radionuclide transport in a coupled fracture-matrix system

Spatial moment analysis of colloid facilitated radionuclide transport in a coupled fracture-matrix system

Ngày tải lên : 05/09/2013, 17:03
... Van Genuchten [31] The parameters used for validation of the numerical results with the analytical solution for radionuclides and colloids are presented in Table and The base case data pertaining ... coefficient attains an asymptotic value As filtration of colloids is progressively increased, dispersion reduces and attains a constant value It can be concluded that significant mixing prevails along ... several kilometers from the nuclear test area in Nevada, U.S was attributed to colloid transport [9] The performance assessment programs of Yucca Mountain project, USA [10] and H-12 of Japan [11]...
  • 14
  • 476
  • 0
Creating a Writing Course Utilizing Class and Student Blogs.doc

Creating a Writing Course Utilizing Class and Student Blogs.doc

Ngày tải lên : 06/09/2013, 05:10
... possible for a teacher to create as many “class blogs” as deemed necessary to organize class materials For example, it must be possible for a teacher to create a blog for class notes and another for ... server space If one has HTML experience and server space, a few more options for creating the class are available that fall beyond the scope of this paper Features of the Blog-Based Class Before ... Internet at anytime Teachers can give collective feedback to the class when a recurring mistake is found by adding entries to a “Writing Feedback” class blog Additionally, individual feedback can be...
  • 7
  • 685
  • 0

Xem thêm