creating a rule base

... within a standard The standard associated with certifications is an American National Standard and an ISO/IEC Standard 17024 It addresses the requirements of a certification program that looks at ... organizations and, since 2009, educational certificate programs based on American National Standards or ISO International Standards To date, ANSI has accredited 30 certification bodies, and is ... credentials are expensive These pathways are not always available in all locations and competencies And analyses of job task analyses and knowledge, skills, and abilities are sometimes defined or assessed...

Ngày tải lên: 16/02/2014, 03:20

... , algorithmic definition A procedural, knowledge-based approach comprising a set of rules that can assign relative importance values to the different parts of a text and can resolve or explain ... conflicting evaluations seems more appropriate Such an approach allows taking into account in a flexible and natural way the variety of knowledge sources and processing a c t i v i t i e s that are involved ... ISA Frame Activation IF a proposition P represents an ISA relation AD N P has importance value w(P) > low A D N the predicate of P is the header of a frame F in the encyclopedia THEN activate...

Ngày tải lên: 09/03/2014, 01:20

... Phrase Attachment In Proc ARPA Workshop on Human Language Technology, pages 250 –255 References E Brill and P Resnik 1994 A rule- based approach to prepositional phrase attachment disambiguation ... Head-Driven Statistical Models for Natural Language Parsing Phd thesis, University of Pennsylvania, Philadephia, PA A Dubey 2005 What to when lexicalization fails: parsing German with suffix analysis ... in fact systematically overestimated We therefore adopted his approach and artificially inflated all noun+preposition counts by a constant factor i To estimate an appropriate value for this factor,...

Ngày tải lên: 17/03/2014, 04:20

... going to a restaurant or taking a train trip In the current context, the main script deals with the various aspects of a graduate student taking a qualifier There are parameters to a script, called ... conversation as the program gathers new information about the entities it already knows something about For example, if the program knows that graduate students want to pass a particular test, and ... the incorporation and integration of a rule- based parser into the system, along with some form of rule- based English generation Another related system, MICS [3], had research goals and a set of...

Ngày tải lên: 17/03/2014, 19:21

... CCAAATTTG CCATATTAGGACA CAGGATGTCCATATTAGGACATC model Ref [17] Ref [14] Transfac ID: R00466 iTriplet Prediction only Published Remarks TTTTATTTATTTTT TTTTAAT TKTWAATA WWTTATTTATTWW TTTTAT and ... Davila J, Balla S, Rajasekaran S: Fast and practical algorithms for planted (l, d) motif search IEEE/ACM Trans Computational Biology & Bioinformatics 2007, 4:544-52 Pisanti N, Carvalho AM, Marsan ... polyA tail addition to the upstream fragment [25] Two main sequence motifs are important for cleavage/polyadenylation of mammalian mRNAs The highly conserved and well-understood AAUAAA motif (called...

Ngày tải lên: 12/08/2014, 17:20

... semantic classification error rate was affected by the following factors: • Use of rule based features only, N-gram based features only, or both rule and N-gram based features Data Rules NGrams Both ... these features are defined by hand-coded rules, and some by surface utterance characteristics like word Ngrams The available data is used to train statistics which evaluate each feature's reliability ... of training data available, and the statistical methods used are simple and unsophisticated However, we still get a significant improvement on rules alone by adding a trainable component An obvious...

Ngày tải lên: 08/03/2014, 21:20

... prepared by Tom Keenan 6The average length of a word in our Chinese data was 1.60 characters AB xB Ay ABC JAB JAB ABK AB~K xA y xAB y xABC y Rule ¢==~ ¢=:¢, ~ ~ ~ ~ ~ A x A A B B y B C JAB -~JA ... to obtain a better approximation of the desired segmentation Furthermore, since all the rules are purely character-based, a sequence can be learned for any character set and thus any language We ... For one, it is weakly statistical, but not probabilistic; transformation-based approaches conseo,:~,tly require far less training data than most o ;a~ is~ical approaches It is rule- based, but relies...

Ngày tải lên: 17/03/2014, 23:20

... where au,t+1 is the true user action Rule- based Dialogue Management A rule- based dialogue manager was developed as a meaningful comparison to the trained DM, to obtain training data from human-system ... policies are obtained by dialogue simulations with user models based on data obtained from humanmachine dialogues with the original rule- based dialogue manager The web tool is available at http://cicerone.dit.unitn.it/ ... uniform way This facilitates dialog evaluation, data mining and online learning because data is available for querying as soon as it has been stored There is no need for separate logging mechanisms...

Ngày tải lên: 23/03/2014, 17:20

... SAP-1 for classification of student performance, the SAP-2 dataset is used Data Driven FRBS—Steps Subsethood-Based Rule Generation Algorithm (SBA) handle classification problems classify training ... Outline Basic concepts of academic performance evaluation Basic concepts of Fuzzy Rule- Based System demonstration Data Driven FRBS Subsethood-Based Rule Generation Algorithm (SBA) Weighted ... training data into subgroups according to the underlying classification results calculate fuzzy subsethood values for every variable in each subgroup create rules Subsethood-Based Rule Generation Algorithm...

Ngày tải lên: 01/07/2014, 12:35

... search focused on diagnostic procedures that Diagnosis AND "low back pain" AND catastrophizing Diagnosis AND "neck pain" AND catastrophizing Diagnosis AND "low back pain" AND coping Diagnosis AND ... to as "red flags" [3] Diagnosis AND "low back pain" AND McKenzie Diagnosis AND "neck pain" AND McKenzie Diagnosis AND "low back pain" AND neurodynamics Diagnosis AND "neck pain" AND neurodynamics ... to measure fear and catastrophizing Regarding fear, the best studied are the Fear-Avoidance Beliefs Questionnaire [57], the Tampa Scale for Kinesiophobia [58] and the Fear-Avoidance Pain Scale...

Ngày tải lên: 13/08/2014, 14:20

... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web-based model make it portable to be delivered ... all logic data of application Separating logic data from application into it will make program scalable and higher performance Most of web applications today use Relational Database Management System ... System There are many kinds of GIS applications: desktop-based GIS, web-based GIS, and mobile-based GIS The most popular GIS applications are desktop-based, almost of them have database included...

Ngày tải lên: 27/10/2012, 16:40

Ngày tải lên: 07/04/2013, 17:11

... 14 // 15 InitializeComponent(); 16 17 // call the Fill() method of sqlDataAdapter1 18 // to populate dataSet11 with a DataTable named 19 // Customers 20 sqlDataAdapter1.Fill(dataSet11, "Customers"); ... data stored in dataView1 to dataGrid1 and allows dataGrid1 to access any data stored in dataView1 Figure 13.2: Setting the Properties of dataGrid1 Select View ➣ Code and set the Form1() ... "Customers"); 21 } Compile and run your form by pressing Ctrl+F5 Figure 13.3 shows the running form Notice that the information in the form comes from the DataView you created Figure 13.3: The running...

Ngày tải lên: 20/08/2013, 16:48

... provide an important basis for analyzing the heat transfer process of BHEs in a sand-based aquifer, and also be applied for other porous materials with the grain diameter of 0.1-0.6mm Theoretical ... void ratio, 2001, Canadian Geotechnical Journal, 2004, 41(5),787-795 [10] Lei S, Hao J, An Z, Experimental study on air based and water based permeability of screened washed sands,Journal of ... Figure Diagram of the experimental setup measuring the hydraulic permeability of sand layer based on the CR method 3.2 Data treatment The porosity φ was tested according to the national standard Soil...

Ngày tải lên: 05/09/2013, 17:03

... possible for a teacher to create as many “class blogs” as deemed necessary to organize class materials For example, it must be possible for a teacher to create a blog for class notes and another for ... server space If one has HTML experience and server space, a few more options for creating the class are available that fall beyond the scope of this paper Features of the Blog-Based Class Before ... individual student blogs In order to save time when giving feedback, save a copy of the messages at an additional teacher-only blog If a class is taught for several years with different students, teachers...

Ngày tải lên: 06/09/2013, 05:10

... handles and user data (see GUIDATA) varargin command line arguments to untitled (see VARARGIN) Add this code Autogenerated code % Create the data to plot handles.peaks=peaks(35); handles.membrane=membrane; ... “Adding Code to the Opening Function” on page 2-20 and “Adding Code to the Callbacks” on page 2-22, contain examples You can share data between callbacks by storing the data in the MATLAB handles ... callback, and an output function callback Each callback is a subfunction that initially consists of a framework that contains just a function definition You must add code to the callbacks to make them...

Ngày tải lên: 29/09/2013, 20:20

... automatically create a total for the year; you would have to create a calculation for the annual total 10 CHAPTER ■ CREATING A PIVOT TABLE You should rearrange the data, using actual dates (if available) ... visible CHAPTER ■ CREATING A PIVOT TABLE Creating an Excel Table from the Worksheet Data • As a final step in preparing the Excel source data, you should format the worksheet data as an Excel Table, ... 13 Create a pivot table from the normalized list, with Name and Region in the Row Labels area, Month in the Column Labels area, and Amount in the data area CHAPTER ■ CREATING A PIVOT TABLE 1.8...

Ngày tải lên: 09/10/2013, 12:20

... installation and maintenance can be accomplished quickly and easily Additionally, easy access at the MST facilitates maintenance and troubleshooting by allowing technicians to simply unplug a connector ... instructions and materials for cleaning hardened connectors and adapters To clean the connector and adapter, the dust caps and plugs are removed to expose the inner optical components The adapter can then ... non-technical field installation of the drop cable Cleaning techniques for these hardened connectors have also been simplified, enabling improved reliability and maintenance Kits are available with easy...

Ngày tải lên: 27/10/2013, 00:15

... mySqlConnection.CreateCommand(); mySqlCommand.CommandText = selectString; SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); ... Northwind database and returns a DataSet containing rows from the Customers table You pass a WHERE clause to the RetrieveCustomers() method in the whereClause parameter; this WHERE clause is then ... Northwind database Because the code uses classes in the System.Data.SqlClient namespace, you'll also need to add the following line near the top of your Customers.asmx.cs file: using System.Data.SqlClient;...

Ngày tải lên: 28/10/2013, 19:15