creating a new virtual machine based deployment
Tài liệu Creating a New Access Database pptx
Ngày tải lên :
24/12/2013, 05:15
... @"Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" + fileName + ";"; // Use ADOX to create the Access database ADOX.Catalog cat = new ADOX.Catalog( ); try { cat.Create(connectString); } finally { cat = null; } } Discussion ADO ... in a database You can use ADOX from NET through COM interop to create a new Microsoft Access database Use the Create( ) method of the ADOX.Catalog object, passing a connection string for the new ... Access database " + fileName + " created.", "Create Access Database", MessageBoxButtons.OK, MessageBoxIcon.Information); } catch (System.Exception ex) { MessageBox.Show("Could not create database...
- 3
- 412
- 0
Tài liệu Creating a New SQL Server Database doc
Ngày tải lên :
21/01/2014, 11:20
... executes a DDL CREATE DATABASE statement to create a new database on a SQL Server You can programmatically drop the database by using the DROP DATABASE statement in a similar way To drop the database ... Oracle databases and other databases is similar to that shown for SQL Server although the DDL syntax for each database varies slightly because of differences in database server capabilities and ... statements generally require DBA permissions to execute Database Management Language (DML) Used to manipulate—select, insert, update, and delete—data in the database objects Database objects are...
- 3
- 410
- 1
Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx
Ngày tải lên :
08/03/2014, 07:20
... accuracy as the beam is narrowed DARPA Speech and Natural Language Workshop T Briscoe and J Carroll 1993 Generalized LR Parsing of Natural Language (Corpora) with Unification -Based Grammars Computational ... contains Ideally we would like to integrate POS tagging into the parsing model rather than treating it as a separate stage This is an area for future research The Parsing Algorithm The parsing algorithm ... Natural Language Work We have shown that a simple statistical model based on dependencies between words can parse Wall Street Journal news text with high accuracy The method is equally applicable...
- 8
- 320
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
Ngày tải lên :
17/03/2014, 03:20
... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers ... 667–674 239 CAGCTgtaag/tccagGTCTG A B C D 163 243 671 261 CAGCTgtaag/tccagGTCTG GGGCGgtgag/tccagTTGAA AGGCGgtgag/caaagCTGAA GACCGgtaag/tccagCTGCT CTGTGgtgag/tgcagGAGGC (110) GACCGgtaag/tccagCTGCT...
- 10
- 451
- 0
báo cáo hóa học: " Intervention to enhance skilled arm and hand movements after stroke: A feasibility study using a new virtual reality system" pot
Ngày tải lên :
19/06/2014, 10:20
... location and movement of the paretic hand via a magnetic marker placed either in the palmar surface of a glove or directly onto the dorsum of the hand at the 3rd metacarpal head Both visual and ... design, data analysis and interpretation, and drafted the manuscript SY, YJ, HJ, and LL participated in system design and data analysis MW and SC designed and coordinated the experimental protocol ... The author(s) declare that they have no competing interests and assisted with data collection, analysis, and interpretation MM and AR conceived of the study and helped in system design, data analysis,...
- 6
- 432
- 0
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" pptx
Ngày tải lên :
22/06/2014, 06:20
... measurement Automating the fiber diameter measurement and eliminating the use of the human operator is a natural solution to this problem Image Analysis An image analysis based method was proposed ... diameter measurement The method is automated, accurate, and much faster than manual method and has the capability of being used as an on-line technique for quality control References A. K Haghi, ... this image at all points along the Nanoscale Res Lett (2007) 2:597–600 599 the most important features of simulation is that it allows several structural characteristics such as fiber diameter and...
- 4
- 296
- 0
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" ppt
Ngày tải lên :
22/06/2014, 18:20
... measurement Automating the fiber diameter measurement and eliminating the use of the human operator is a natural solution to this problem Image Analysis An image analysis based method was proposed ... diameter measurement The method is automated, accurate, and much faster than manual method and has the capability of being used as an on-line technique for quality control References A. K Haghi, ... this image at all points along the Nanoscale Res Lett (2007) 2:597–600 599 the most important features of simulation is that it allows several structural characteristics such as fiber diameter and...
- 4
- 330
- 0
Mate: A Tiny Virtual Machine for Sensor Networks
Ngày tải lên :
15/02/2016, 10:03
... International Symposium on Computer Architecture, 1993 [27] Brian D Noble, M Satyanarayanan, Dushyanth Narayanan, James Eric Tilton, Jason Flinn and Kevin R Walker Agile application-aware adaptation ... the data in the second operand onto the first operand Adding a value to a message appends the value to the message data payload Adding a sensor reading to a value results in a sensor reading ... expensive tasks such as earthquake damage assessment can be made fast and simple [1] Such a network would be very useful for a wide variety of tasks, such as water damage detection or sound propagation...
- 11
- 560
- 1
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
Ngày tải lên :
26/10/2012, 09:07
... of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon cage are ... Gd@C60[C(COOH)2]10 as a MRI contrast agent J Am Chem Soc 2003; 125: 5471-8 Okumura M, Mikawa M, Yokawa T, et al Evaluation of water-soluble metallofullerenes as MRI contrast agents Acad Radiol 2002; ... Then the organic phase was washed with water, followed by 1N-HCl and again water The organic layer was dried over Na2SO4 and evaporated The resulting residue was chromatographed on silicagel by elution...
- 11
- 655
- 0
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx
Ngày tải lên :
23/01/2014, 07:20
... this as an input to a separate "playback" application The "playback" is not strictly a playback in the sense that users are still allowed to move about and interact in the virtual world An example ... PROTOTYPING/MANUFACTURING AND VR The terms virtual prototyping and virtual manufacturing are commonly used in academia and industry and can be easily confused with virtual reality (technology or applications) ... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2...
- 10
- 634
- 1
Tài liệu GIVING CREDIT WHERE CREDIT IS DUE: CREATING A COMPETENCY-BASED QUALIFICATIONS FRAMEWORK FOR POSTSECONDARY EDUCATION AND TRAINING pdf
Ngày tải lên :
16/02/2014, 03:20
... within a standard The standard associated with certifications is an American National Standard and an ISO/IEC Standard 17024 It addresses the requirements of a certification program that looks at ... organizations and, since 2009, educational certificate programs based on American National Standards or ISO International Standards To date, ANSI has accredited 30 certification bodies, and is ... credentials are expensive These pathways are not always available in all locations and competencies And analyses of job task analyses and knowledge, skills, and abilities are sometimes defined or assessed...
- 46
- 477
- 0
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx
Ngày tải lên :
07/03/2014, 21:20
... Fig.2) amyAspka a- amylase amyAspnd a- amylase amyBacsp a- amylase amyCrysp a- amylase amyStrgr a- amylase amyStrlm a- amylase amyStrli1 a- amylase amyStrli2 a- amylase amyStrvi a- amylase amyThncu a- amylase ... 2.4.1.19 AAP31242 AAB65420 CAA55023 CAA48401 AAG31622 BAB91217 CAA33763 AAA22298 P31835 BAA14289 AAA22308 ALBSX1 AAA22310 AAA22309 CAA46901 BAA31539 AAA22239 CAA01436 Z34466 BAA02380 CAA41770 AAD00555 ... emersonii Aspergillus awamori Aspergillus niger T21 Neurospora crassa AAB02927 AAT58037 BAA00331 AAB59296 AAB20818 BAA01254 L15383 BAA08436 CAA47945 AAA33386 AAF75523 AAE15056 AAR61398 BAD06004 AAP04499...
- 17
- 476
- 0
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc
Ngày tải lên :
08/03/2014, 06:20
... and a semantic role of a head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer (Kurohashi and Nagao, ... the case analysis 4.2 Algorithm Given an input phrase N1 no N2, b o t h D B A and SBA are applied to the input, and then the two analyses are integrated 4.2.1 Dictionary -based Analysis Dictionary ... the parsing system In Proceedings of the First International Conference on Language Resources ~ Evaluation, pages 719724 Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto...
- 8
- 553
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
Ngày tải lên :
08/03/2014, 18:20
... early as ill-formed In Figure we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example illustrates a number of instances of ... ngarrka.ngku.ka marlu marna.kurra luwa.rnu ngarni.nja.kurra 'The man is shooting the kangaroo while it is eating grass.' Figure 2b is the syntactic representation for that sentence Note that the...
- 8
- 522
- 0
Báo cáo khoa học: "A New String-to-Dependency Machine Translation Algorithm with a Target Dependency Language Model" pot
Ngày tải lên :
17/03/2014, 02:20
... Schwartz, L Micciulla, and J Makhoul 2006 A study of translation edit rate with targeted human annotation In Proceedings of Association for Machine Translation in the Americas W Wang, K Knight, and ... 2003 Syntaxbased language models for statistical machine translation In Proceedings of MT Summit IX D Chiang 2005 A hierarchical phrase -based model for statistical machine translation In Proceedings ... red apple ) = LA(cat(Da ), LA(cat(Dred ), cat(Dapple ))) (b) Figure 6: Operations over well-formed structures = LA(LC(cat(Da ), cat(Dred )), cat(Dapple )) vantage of various translation fragments...
- 9
- 442
- 0
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
Ngày tải lên :
17/03/2014, 02:20
... evaluation, common in the machine translation domain and already used for paraphrase evaluation (Bannard and Callison-Burch, 2005) The question asked to the human evaluator for the syntactic task ... because a statistical paraphrase table, an analogical solver and a paraphrase memory for instance; there is no constraint on the scoring function because it only scores final states Note that ... state-of-the-art to generate paraphrases Colin Bannard and Chris Callison-Burch 2005 Paraphrasing with bilingual parallel corpora In Annual Meeting of ACL, pages 597–604, Morristown, NJ, USA Association...
- 4
- 338
- 0
Báo cáo khoa học: "A Novel Discourse Parser Based on Support Vector Machine Classification" docx
Ngày tải lên :
30/03/2014, 23:20
... discourse parser based on supervised machine- learning algorithms, using a feature-driven approach and a manually annotated corpus Importantly, our system achieves its accuracy in linear complexity ... gold standard) Standard performance indicators for such a task are precision, recall and F-score as measured by the PARSEVAL metrics (Black et al., 1991), with the specific adaptations to the case ... impact of using homogeneous newspaper articles that could carry important biases in prose style and lexical 2.3 Input Data and Feature Extraction Both S and L classifiers are trained using manually...
- 9
- 390
- 0
báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx
Ngày tải lên :
19/06/2014, 10:20
... Understanding virtual reality: Interface, application, and design California: Morgan Kaufmann; 2002 Stanney KM: Handbook of Virtual Environments: Design, Implementation, and Applications New Jersey: ... Rizzo AA, Kim G: A SWOT analysis of the field of virtual rehabilitation and therapy Presence: Teleoperators and Virtual Environments in press Rizzo AA, Schultheis MT, Kerns K, Mateer C: Analysis ... Erlbaum Assoc; 2002 Arthur K, Booth KS, Ware C: Evaluating human performance for Fishtank Virtual Reality ACM Transactions on Information Systems 1993, 11:239-265 Cruz-Neira C, Sandin DJ, DeFanti...
- 2
- 360
- 0
báo cáo hóa học: " A new definition of burnout syndrome based on Farber''''s proposal" pptx
Ngày tải lên :
20/06/2014, 00:20
... Occupational Medicine and Toxicology 2009, 4:31 Method We have adopted a qualitative social research approach and make use of the strategy known as documentary analysis [16] The documentation ... qualitative research In Handbook of Qualitative Research Edited by: Denzin N, Lincoln Y California: Sage; 1994 Barton AH, Lazarsfeld PF: Some functions of Qualitative Analysis in Social Research ... elemental relations, we formalized a classification criterion that finally gave meaning to the conceptual structure of the entire typology As can be appreciated, we have chosen a large combination...
- 17
- 604
- 0