... the type of router as well as how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers ... possible combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN ... prompted for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config Router#erase startup-config...
Ngày tải lên: 04/11/2013, 16:15
... this task Finally, we compare our approach to a stateof-the-art tagger, based on Brill's transformation based approach; we show that SNOWbased taggers already achieve results that are comparable ... training data, and will allow the algorithm to adapt to the new context For example, a language acquisition system with a tagger trained on a general corpus can quickly adapt to a specific domain, ... f a d a p t a t i o n : Performance of the tagger network with no adaptation(noadp-SNOW), baseline adaptation(SNOH0, and true adaptation(adp- SNOW) One difficulty in applying the SNOW approach...
Ngày tải lên: 23/03/2014, 19:20
Báo cáo hóa học: "Particle Filtering Algorithms for Tracking a Maneuvering Target Using a Network of Wireless Dynamic Sensors" doc
... where x , νs > are adjustable parameters that control the variance of the propagation process, and zx,t , zs,t are complex Gaussian vectors with zero mean and covariance matrices I2 and INs ... (42) although alternatives exist that enable the parallelization of the CRPF algorithm if necessary [21] The propagation scheme for σt is given by the pair of equations xt = Axt−1 + x Ts zx,t ... problem of tracking a maneuvering target that moves along a 2-dimensional space using a WSN It is assumed that each sensor can measure some physical magnitude related to the distance between the target...
Ngày tải lên: 22/06/2014, 23:20
Báo cáo khoa học: "Creating a Corpus of Parse-Annotated Questions" docx
... al (2005) The research established that even a small amount of additional training data can give a substantial improvement in question analysis in terms of both CFG parse accuracy and LFG grammatical ... 498 Algorithm Induce a parse-annotated treebank from raw data repeat Parse a new section of raw data Manually correct errors in the parser output Add the corrected data to the training set Extract ... a new grammar for the parser until All the data has been processed were being produced at an average rate of 40 trees per day During the later stages of the project this had changed dramatically...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: Intrinsic local disorder and a network of charge–charge interactions are key to actinoporin membrane disruption and cytotoxicity ppt
... side facing the membrane is dramatically changed (Fig 4) Finally, as 15N NMR relaxation can be used to characterize the dynamic properties of a protein in solution, relaxation data were obtained ... lack of positive charge, maintains the polar character and the possibility of donating H-bonds In the Y111N variant, the aromatic ring is replaced by a group which is also structurally planar ... The Authors Journal compilation ª 2011 FEBS M A Pardo-Cea et al Structure of R29Q and Y111N StnII mutants Table NMR structural calculations summary and statistics StnII-R29Q Calculation Distance...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo hóa học: " A Network of Kalman Filters for MAI and ISI Compensation in a Non-Gaussian Environment Bessem Sayadi" doc
... observation matrix A( k) is a constant matrix A In this paper, we suppose that the convolution code-channel matrix is invariant on a slot duration We also remark that the dimension of the observation ... probability of the state vector p(d(k)|R(k)) by a weighted sum of Gaussian terms (see the appendix) where each Gaussian term parameter adjusted using one Kalman filter This approach was initially ... that is to be approximated The covariance matrices Gi are determined in order that the approximation error p − pA is minimized according to a desired criterion APPENDIX GAUSSIAN SUM APPROXIMATION...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo khoa học: " Estimation of Paratuberculosis Prevalence in Dairy Cattle in a Province of Korea using an Enzyme-linked Immunosorbent Assay: Application of Bayesian Approach" ppt
... available and gold standard diagnosis is unavailable Stat Med 1996, 15(5), 463-476 Faraone, S V and Tsuang, M T Measuring diagnostic accuracy in the absence of a ‘ gold standard’ Am J Psychiatry ... the context of Bayesian analysis, in particular, for a single diagnostic test with small sample size relative to the number of parameters to be estimated, at least two of the three parameters ... Bayesian estimation of asthma prevalence, and comparison of exercise and questionnaire diagnostics in the absence of a gold standard Ann Epidemiol 1998, 8(3), 201-208 Diamond, G A. , Rozanski, A. , Forrester,...
Ngày tải lên: 07/08/2014, 17:22
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga VIRvsLTNP CD8 1.3 2.3 PSMA5 NM_002790.2 proteasome subunit, alpha type, PSMA5L tgaatgcaacaaacattgagc PSMA5R ttcttcctttgtgaacatgtgg VIRvsLTNP CD8 2.7 ... NADH to OXPHOS, and a wide range of metabolic pathways (carbohydrate, fatty acid, protein, and amino acid metabolism pathways) furnishing substrates to the TCA cycle are coordinately up-regulated...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Validation and refinement of gene-regulatory pathways on a network of physical interactions" pps
... we have explored a framework for modeling transcriptional networks in which experimental design and validation are central features This framework is based on computational analysis and expression ... not change as a result of the knockout In the updated Model 1, MSN4 and HAP4 were unambiguously annotated as inducers of downstream genes, SOK2 was annotated as a repressor of MSN4 and HAP4, and ... physical explanation by which a deleted gene regulates a second gene downstream From the expression data, each interaction on a path was annotated with its probable direction of information flow and...
Ngày tải lên: 14/08/2014, 14:21
Creating a culture of learning in 6 steps
... potential of your organization by maximizing the potential of all the people in it | Creating a Culture of Learning in Steps | Lynda.com The benefits of transformative learning Creating a transformative ... learning as a path to mastery Make it safe to take risks—and to make mistakes Celebrate “Aha!” moments as much as easy wins Encourage risk taking and failure Understand that the cost of not encouraging ... demand and in person 10 | Creating a Culture of Learning in Steps | Lynda.com Value learning as a path to mastery 11 | Creating a Culture of Learning in Steps | Lynda.com STEP NO Value learning...
Ngày tải lên: 30/11/2015, 00:51
On the move creating a culture of business growth
... theme at some of these sessions, Xexox dreamed up one particularly intriguing idea: creating erasable paper by making ink disappear from a printed page and then reusing the paper as if it were brand ... purchase, the company continued to expand its global reach and its managed network, security and IT services “We had already started down the path where we saw companies wanting to buy things as a ... Opportunities to gain a competitive edge A recession is a terrible thing to waste (to borrow a famous phrase of the Obama administration), because rivals are often too weak to prepare for a business...
Ngày tải lên: 06/12/2015, 23:09
The intelligent enterprise creating a culture of speedy and efficient decision making
... education and digital It was an integrated team of senior management at Tata Motors that last year helped the giant Indian carmaker blunt the impact of the financial crisis that sent two of the ... respondents) Marketing and sales 19 United States of America 34 IT 18 India United Kingdom Operations and production 13 Risk 10 France Germany Canada China Mexico Singapore Spain Australia, Austria, Brazil, ... came to the conclusion that this was not a panic reaction on our part, just an extraordinary event that called for an extraordinary response,” explains Mr Telang He credits the dealer information...
Ngày tải lên: 06/12/2015, 23:13
Báo cáo y học: "Dissection of a DNA-damage-induced transcriptional network using a combination of microarrays, RNA interference and computational promoter analysis" pot
... 5'-GATCCCCCTGGTTAGCAGAAACGTGCTTCAAGAGAGCA CGTTTCTGCTAACCAGTTTTTGGAAA-'3 ATM_II (p480): 5'-GATCCCCGATACCAGATCCTTGGAGATTCAAGAG ATCTCCAAGGATCTGGTATCTTTTTGGAAA-3', a generous gift from R Agami (ATM ... was knocked-down using a combination of two different siRNAs.) Rel _A: 5'-GATCCCCGAAGAGTCCTTTCAGCGGATTCAAGAGATCCGCTGAAAG GACTCTTCTTTTTGGAAA -3' p53: 5'-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTG ... 5'-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTG GAGTCTTTTTGGAAA-'3 (previously described in Brummelkamp et al [24]) LacZ: 5'-GATCCCCAAGGCCAGACGCGAATTATTTCAAGAGAATAATTCGCGTCT GGCCTTTTTTTGGAAA-3' http://genomebiology.com/2005/6/5/R43...
Ngày tải lên: 14/08/2014, 14:21
A Knowledgeable Model: Network of C-Objects
... where A3 f 2→ A4 f 3→ A5 f 4→ O2 A6 → A7 A0 = A = {O1 .a , O1 .A} , A1 = {O1 .a , O1 .A, O2 .A} , A2 = { O1 .a , O1 .A, O2 .A, O1.b, O1.c }, A3 = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a} , A4 = ... F ∪ O Put A0 = A, A1 = t1 (A0 ), , Am = tm(Am-1), and D (A) = Am, we have A0 ⊆ A1 ⊆ ⊆ Am = D (A) ⊆ M A problem A → B on a network (O,F) is called solvable if and only if there is a sequence ... = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a, O4 .a} , A5 = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a, O4 .a, O2.b}, A6 = {O1 .a , O1 .A, O2 .A, O1.b, O1.c, O3 .a, O4 .a, O2.b, O2.c}, A7 = {O1 .a , O1 .A, O2 .A, O1.b,...
Ngày tải lên: 18/09/2012, 10:13
Báo cáo y học: "A case of mistaken identity: Asystole causing convulsions identified using implantable loop recorder"
... no conflict of interest exists Zaidi A, Clough P, Cooper P, Scheepers B, Fitzpatrick AP Misdiagnosis of epilepsy: many seizure-like attacks have a cardiovascular cause J Am Coll Cardiol 2000;36(1):181-4 ... 210 diagnosed as epilepsy (1, 2, 3) An ILR can be invaluable in identifying these patients and facilitating prompt therapy (3) Conflict of Interest References The authors have declared that no ... 2000;36(1):181-4 Kanjwal K, Kanjwal Y, Beverly K, Grubb BP Clinical Symptoms Associated with asystolic or bradycardic responses on implantable loop recorder monitoring in patients with recurrent...
Ngày tải lên: 26/10/2012, 08:57
Creating a dataview using visual studio NET
... data stored in dataView1 to dataGrid1 and allows dataGrid1 to access any data stored in dataView1 Figure 13.2: Setting the Properties of dataGrid1 Select View ➣ Code and set the Form1() ... method of sqlDataAdapter1 18 // to populate dataSet11 with a DataTable named 19 // Customers 20 sqlDataAdapter1.Fill(dataSet11, "Customers"); 21 } Compile and run your form by pressing Ctrl+F5 ... Form1() method of your form to 10 public Form1() 11 { 12 // 13 // Required for Windows Form Designer support 14 // 15 InitializeComponent(); 16 17 // call the Fill() method of sqlDataAdapter1 18 //...
Ngày tải lên: 20/08/2013, 16:48
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model
... disposal of hazardous waste (co-disposal) Since the data available on the quantity, age, and composition of the refuse in the landfill are limited, using a more sophisticated calculation was not attempted ... maximum NMOC total annual mass emission rate to be 1.66 x 10-7 kg/year and 1.78 x 10-7 kg/year respectively The mean, variance, and standard deviation are 1.72 x 10-7 kg/year, 2.12 x 10-18, and ... emission rate of NMOC based on the variability of the concentration of NMOC, the age of the landfill and the annual refuse acceptance rate For example, a comparison of the result of the probabilistic...
Ngày tải lên: 05/09/2013, 16:11
Customizing a Network Using the Registry phần 1
... undesirable, since all traffic can be redirected to a gateway that is not constantly monitored Because of this reason, set this parameter to EnablePMTUDiscovery (REG_DWORD data type) The default value ... (REG_DWORD data type) The default value (1) enables TCP/IP to switch to a secondary gateway if many connections experience problems However, in cases when you are under a DoS attack, such behavior ... value for 300000 SynAttackProtect (REG_DWORD data type) Creating this value will enable you to provide minimum protection against a specific type of DoS attack known as SYN Flood SYN Flood attacks...
Ngày tải lên: 07/11/2013, 08:15
Customizing a Network Using the Registry phần 2
... with a time source that is at a different site GetDcBackofMaxTimes REG_DWORD The maximum number of = The wait between times to double the back attempts is at a off interval when minimum and no ... domain hierarchy or manually configured source Value name Table 8.3: W32Time Service Registry Values Data type Description Values [default] NTP = synchronize to manually configured source Adj ... service synchronizes = Always start the SNTP server Blank by defaut Sample data value: 192.4.41.40 = once a day 65535, every days 65534, every days 65533, every week (7 days) 65532, every 45 minutes...
Ngày tải lên: 07/11/2013, 08:15