... displaced lo- cal obstacles can also been encountered by the robot. So a natural way to obtain an efficient and safe nav- igation in such an environment is to integrate global planning and local ... models and super- vised learning, in: Proceedings of the Eighth International Workshop on Machine Learning, Ithaca, NY. 1991, pp. 70–74. [10] L.N. Kanal, J.F. Lemmer, Uncertainty in Artificial Intelligence, ... initial point till the target point by follow- ing as nearly as possible the optimal way without tak- ing into account the missing obstacles and avoiding the unexpected obstacles. For this, a...
Ngày tải lên: 23/10/2013, 15:15
fish, fishers, seals and tourists- economic consequences of creating a marine reserve in a multi-species, multi-activity context
Ngày tải lên: 04/03/2015, 10:25
Tài liệu Creating a Class That Participates in an Automatic Transaction ppt
... programmatically to participate automatically in an existing transaction, to start a new transaction, or to not participate in a transaction. The following steps prepare a class to participate in ... they can participate in an automatic transaction. Once an object is marked to participate in a transaction, it will automatically execute within a transaction. The object's transactional ... transactions that span multiple remote databases and multiple resource managers. ã Objects participating in automatic transactions do not need to anticipate how they might be used within a...
Ngày tải lên: 24/12/2013, 05:15
Tài liệu Protecting games in a mobile world docx
... release of games, but many methods are the same and can be applied for mobile applications as well. While I am not studying at the university I am working at Imotus Mobile Games, which gave ... to a special byte code that runs on a special virtual machine that is adapted to all the handset models that are supported. 2 For a game to run it has to have a valid certificate from Synergenix. ... languages and platforms here but at least some of them in general. Java Java is probably the first thing that people think about when mobile games are mentioned. Supported by 2.5 million handsets...
Ngày tải lên: 16/01/2014, 16:33
Tài liệu Creating a Table in the Database from a DataTable Schema docx
... Table in the Database from a DataTable Schema Problem You need to create a table in a database from an existing DataTable schema. Solution Use the CreateTableFromSchema( ) method shown in this ... CreateTableFromSchema( ) in the sample code is called to create a table in the database from this schema. CreateTableFromSchema( ) This method creates a schema in the database for the schema of the DataTable ... dynamically constructs a Data Definition Language (DDL) statement to create a table in a SQL Server database from the schema of a DataTable. The complete statement that is generated is shown in...
Ngày tải lên: 21/01/2014, 11:20
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... by the p53 family proteins may have impacts on regulation pathways in cisplatin- treated cells. Abbreviations cisPt-DNA, cisplatin-modified DNA; CTDBS, C-terminal DNA-binding site; EMSA, electrophoretic ... preferential binding to globally cis-platinated DNA [31,33,34]. Binding of p73 proteins to the recognition elements is affected by DNA cis-platination in a similar way to p53 binding In agreement ... sequence-specific DNA binding of p53 and p73 proteins in a target site- dependent manner Hana Pivon ˇ kova ´ 1 , Petr Pec ˇ inka 1 , Pavla C ˇ es ˇ kova ´ 2 and Miroslav Fojta 1 1 Institute of Biophysics, Academy...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx
... variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic -site mutation resulting in a well-folded but totally inactive protein Linda P. O’Reilly 1, *, ... ferricenium assay after a 10-min incubation at the temperature indicated (error bars ẳ standard deviation of the mean), and (B) the amount of tetramer present, as determined by western blot analysis ... either mask or enhance the clinical manifestation of the disease [6,26]. Although the individuals with this mutation have remained asymptomatic, the analogous mutations in glutaryl-CoA dehydrogenase...
Ngày tải lên: 20/02/2014, 02:21
Dreamweaver CS5.5 Mobile and Web Development with HTML5, CSS3, and jQuery doc
... animation. David Karlins' consulting clients have ranged from Hewlett Packard to the Himalayan Fair, from AAA Health Insurance to the Association of Alternative Newsweeklies. David Karlins ... Dreamweaver site Most of the features associated with creating HTML5 content in Dreamweaver require that you rst dene a Dreamweaver site. Dreamweaver sites organize and manage all the les you create ... 245 Advantage: App vs web page 246 PhoneGap and Dreamweaver CS5. 5 247 Configuring application framework(s) 247 The App toolkits 248 Installing the frameworks 248 Defining mobile application settings...
Ngày tải lên: 06/03/2014, 00:20
Dreamweaver® CS5.5 Designing and Developing for Mobile with jQuery, HTML5 and CSS3 potx
... understand that Java and JavaScript are completely unrelated languages. JavaScript was originally called LiveScript, but the name was changed by Netscape in what many regard as a misguided marketing ... choosing Insert > jQuery Mobile. Chapters 5 and 6 describe in detail how to use these fea- tures in Dreamweaver CS5. 5. Code Hints for jQuery Core As well as integrating jQuery Mobile into Dreamweaver, ... challenge: creating websites and applications that take advantage of the new features offered by HTML5, CSS3, and related technologies. Only a couple of years ago, accessing the Internet on a mobile...
Ngày tải lên: 06/03/2014, 03:20
Dreamweaver CS5.5 Mobile and Web Development with HTML5, CSS3, and jQuery pptx
... dene a Dreamweaver site. Dreamweaver sites organize and manage all the les you create as you generate the content in Dreamweaver. Moreover, that kind of careful le management is essential in ... header nav, and hgroup 87 Navigation within a header 87 Organizing header content with hgroups 87 Creating articles and sections 88 Adding aside content 90 Creating a footer 91 Adding metadata 92 Defining ... are ready to roll. You now have Dreamweaver enabled to access HTML5 tools. Creating a Dreamweaver site Most of the features associated with creating HTML5 content in Dreamweaver require that you...
Ngày tải lên: 06/03/2014, 03:20
Báo cáo khoa học: "Creating a Gold Standard for Sentence Clustering in Multi-Document Summarization" potx
... 2007 Joint Conference on Empirical Methods in Natural Language Processing and Computational Natural Language Learning (EMNLP-CoNLL), pages 410– 420. Andreas Vlachos, Anna Korhonen, and Zoubin Ghahramani. ... 41–49. Association for Computational Linguistics. Andreas Hess and Nicholas Kushmerick. 2003. Au- tomatically attaching semantic metadata to web ser- vices. In Proceedings of the 2nd International ... paragraphs con- tained ’common information’. They were given the guideline that only paragraphs that described the same object in the same way or in which the same object was acting the same are...
Ngày tải lên: 08/03/2014, 01:20
Sams Teach Yourself Dreamweaver CS5 in 24 Hours pdf
... from a File 64 Copying and Pasting Structural Formatting 65 Applying Text Formatting 66 Understanding Paragraph and Break Tags 67 Setting Page Properties 68 Setting Global Page Appearance ... Many websites have thousands of web pages. Managing all those pages, espe- cially when a change is required, can be a daunting task. Dreamweaver has reusable and updatable pages, called templates, which ... of Dreamweaver TABLE 2.1 Insert Panel Objects Icon Icon Name Description Non-Breaking Space Inserts a special character ( ) that creates a space. The nonbreaking space character also...
Ngày tải lên: 15/03/2014, 10:20
Dreamweaver CS5.5 Mobile and Web Development with HTML5, CSS3, and jQuery ppt
... Inspect Mode 25 Saving a layout as a web page 26 Recipe: Creating and saving a 3-column HTML5 page 27 Summary 29 About the Author David Karlins is a consultant, writer, and teacher on digital ... photography, project management, digital video, and animation. David Karlins' consulting clients have ranged from Hewlett Packard to the Himalayan Fair, from AAA Health Insurance to the Association ... to Dreamweaver, this book explains in detail how to take advantage of the new features available in the latest releases of Dreamweaver that add support for HTML5, CSS3, and jQuery. In addition...
Ngày tải lên: 15/03/2014, 19:20
Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx
... Forward CCACAGAATAACCAAA TTGATCGCCACC Reverse Y18 7A GATGAATTTGGT GCGTCTGTGGAAAG Forward CTTTCCACAGA CGCACCAAATTCATC Reverse W23 7A CCGAATATTGAAATTACTTAT GCGAGCTATGATGGCG Forward CGCCATCATAGCT CGCATAAGTAATTTCAATATTCGG ... Forward CGCCATCATAGCT CGCATAAGTAATTTCAATATTCGG Reverse Y27 8A CCTATTATCTT GCGATTGTTCCGAAAGC Forward GCTTTCGGAACAAT CGCAAGATAATAGG Reverse W330Y GCAGCATTATCGATC TACGGAGAAGATGC Forward GCATCTTCTCC GTAGATCGATAATGCTGC Reverse E332Q ... GCTGGACATCGCC AAACATTTTTATTCACCCG Forward CGGGTGAATAAAAATG TTTGGCGATGTCCAGC Reverse D183N GGTGGC AACGAATTTGGTTATTCTGTGG Forward CCACAGAATAACCAAATTC GTTGCCACC Reverse E184Q GGTGGCGAT CAATTTGGTTATTCTGTGG Forward CCACAGAATAACCAAA TTGATCGCCACC...
Ngày tải lên: 16/03/2014, 06:20
dreamweaver cs5.5, designing and developing for mobile with jquery html5 and css3 (2011)
... Media Queries 73 Adapting the Tozai Hotel Site 82 Assessing Media Queries 115 Chapter 4 Making Your Site Available Offline 117 How Offline Sites Work 118 Making the Tozai Hotel Site Available Offline ... idea was to start from a clean slate, devising a “perfect” markup language without worrying about back- wards compatibility. Tantek ầelik is a respected web standards advocate and principal ... Testing in the Android simulator after packaging the app with Dreamweaver s integrated ver- sion of PhoneGap. Figure 1.19 Testing in the iPhone simulator on Mac OS X. Adobe Dreamweaver CS5. 5...
Ngày tải lên: 21/03/2014, 11:45