creating a method to update the text information

... two parameters into a single measurement that contains both quantitative and qualitative information This study did not attempt to address the role of lactate, but merely sought to validate a method ... -7.4) The unmeasured anionrelated base deficit was greater than the total base deficit; this was predominantly due to the alkalinising effect of hypoalbuminaemia (mean albumin effect on base deficit ... data collection, preliminary data analysis and co-wrote the first draft of the manuscript SMT conceived the study, performed data analysis and co-wrote the first draft of the manuscript AD participated...

Ngày tải lên: 12/08/2014, 22:22

... to detect the ampicillin resistant gene are AmpF (5'-gataacactgcggccaactt-3') and AmpR (5'-ttgccgggaagctagagtaa-3') The reactions were cycled either in a Perkin Elmer thermocycler (DNA Thermal ... (Sigma) was used as an enhancer The reaction was made up to 50 µl with water The primers used to detect HIV-1 LTR are NI2F (5'-cacacacaaggctgacttccct-3') and NI2R (5'gccactccccagtccgccc-3') The ... these factors would similarly affect both the calibration cultures and the sample, allowing a valid, direct comparison of the growth curves To obtain a more precise estimate, an idealised mathematical...

Ngày tải lên: 13/08/2014, 09:20

... recover the information successfully In fading channels, where the instantaneous SNR is a random variable, the average SNR is used as the measure Another standard measure in fading channels is the ... Niranjayan, A Nallanathan and B Kannan, “Exact Modeling of Multiple Access Interference and BER Derivation for TH-PPM UWB”, WCNC 2005, Accepted for publication [5] S Niranjayan, A Nallanathan and ... Furthermore, the channel gain is modeled as a log-normal random variable Therefore, in order to make the analysis theoretically tractable, certain simplifying assumptions are made The channel gain h...

Ngày tải lên: 05/10/2015, 22:04

... H37Ra (MT H37Ra; DIFCO Laboratories, Detroit, MI, USA) was used as an adjuvant to induce arthritis Fresh adjuvant was prepared on the same day as arthritis was induced A volume of 0.1 ml of a mg ... Statistical Package for the Social Sciences software (SPSS Inc Chicago, IL, USA) was used to analyze the data Throughout the study, the mean ± standard error of means was used to describe the ... adjuvant arthritic rats Clin Exp Rheumatol 1999, 17:553-560 40 Segawa Y, Yamaura M, Aota S, Omata T, Tuzuike N, Itokazu Y, Oka H, Tamaki H, Nakamura T: Methotrexate maintains bone mass by preventing...

Ngày tải lên: 09/08/2014, 10:21

... enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has to a brand” Yoo and Donthun (2001) also ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together ... competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand commonly provide the...

Ngày tải lên: 24/09/2012, 17:19

... the remaining stain (if any) dried Such photos were then analyzed to measure the surface stain area using an image analysis system (IAS) We chose the above timing because we found by trial and error ... of each suture line were analyzed to measure the width of the scar using the IAS described earlier STATISTICAL ANALYSIS The unpaired two-tailed student t test was used to compare the means among ... and polyamide Scar formation As far as suture-type associated scar formation, the results showed that the least amount of scar was present when the polyurethane suture was used, as compared to...

Ngày tải lên: 03/11/2012, 11:52

... variations and has been named the EsSense Profile In addition, a 9-point hedonic scale was incorporated into the ballot to evaluate overall acceptability of the product and provide an anchor to ... such as pizza, chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, ... Sensation seeking and positive affect 1.4 Facial scaling Another approach to measuring emotions has been the use of facial scaling A number of different systems for facial scaling have recently appeared...

Ngày tải lên: 03/04/2013, 21:07

... wastewater is treated with secondary treatment and the quality of the water discharged to the river is high They are willing to pay about half as much to increase the treatment capacity of the ... significant Treated wastewater quantity and quality are significant factors in the choice of a wastewater treatment programme, and ceteris paribus, these two attributes increase the probability that ... wastewater the STP is working below its capacity, treating only a quarter of wastewater generated in the municipality The capacity of the STP can however be increased to treat ALL the wastewater...

Ngày tải lên: 18/02/2014, 01:20

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified...

Ngày tải lên: 19/02/2014, 17:20

Ngày tải lên: 05/03/2014, 16:20

... scenario, the activation of growth factor receptors may in turn activate the Ras ⁄ Rac1 pathway, which has been shown to play a critical role in HSF1 activation and HSP up-regulation [14] We have reported ... [13] The overexpression of a desaturase gene in Saccharomyces cerevisiae, or the addition of exogenous fatty acids, can change the unsaturated ⁄ saturated fatty acid ratio and exert a significant ... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways,...

Ngày tải lên: 07/03/2014, 12:20

... 2002, meaning they lack the means to ensure themselves of healthy meals and are vulnerable to at least a mild form of chronic malnutrition.3 WEALTH AND VALUES I live in a home that has heat and running ... excited to read the Financial Times,” she says with a laugh When she was 14, her parents started a restaurant, and she began waitressing at night Her father encouraged her to save up for substantial ... So that weekend I went to Saks locally and told them that I was in New York, had bought all this makeup, came home, and my husband had a fit They took it all back That’s so me—there was no way...

Ngày tải lên: 12/03/2014, 14:51

... of the UNFCCC database and the NAPAs Like the latter, most cases are from sub-Saharan Africa, followed by South and Central Asia and Latin America, but in addition it shows that the vast majority ... interface which is a gateway to information on adaptation practices worldwide – the Local Coping Strategies Database It provides a summary of adaptation practices by a large range of organizations, ... Climate Change in Bangladesh The IFC clearly have the potential to play an important catalytic role in the objective of engaging the private sector in Climate Change Adaptation by both managing a...

Ngày tải lên: 16/03/2014, 14:21

... manager by the event manager Venue Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities Other facilities or amenities in the area and appropriateness ... seminars, where there is a specific need to gather many delegates and speakers together in one place, there are significant opportunities available for ensuring that environmental impacts are minimised ... also It is recommended that this guide is used to help select a suitable venue and to aid planning discussions with management and staff at the venue A copy should be passed to the venue manager...

Ngày tải lên: 16/03/2014, 19:20

... negative  impacts,  especially  in  the future,  when  the province has the plan to develop the aquaculture  to be the key sector of local economics [6].   A re a (h e c ta r s ) January  and  ... The responsibility of the scientists is to screen  among these alternatives the feasible measures  based  on  applicability  and  suitability  for  the local conditions.   2.4. Evaluation criteria   After the problem and its constraints have  ... environment [3]. One of the disadvantages is  that  the relative  importance  of  evaluation  criteria is determined without considering the scales  on  which  the criteria  are  measured.  Another disadvantage is the large amount of ...

Ngày tải lên: 22/03/2014, 12:20

... Applying Metadata What Are Metadata? How Are They Used? What Are the Standards? How Do You Use the Standards? Where Are Metadata Used? What Tools Will Be Needed to Use Metadata? What Will the Impact ... standards, templates, and Information Mapping, the management team tasked the VP of documentation to lead the effort to build the strategy and implementation plan She was given access to key company ... profession to adopt an entirely new way of working— an evolution from an artisanal approach characterized by great flexibility to a more standardized, assembly-line approach Although you may have a gut...

Ngày tải lên: 09/04/2014, 16:28

... such a way that the toolbar is just another menu with a special name Hence, adding an icon to the toolbar is just like adding an item to a menu In the case of a 'toolbar menu', you will be able to ... 1991 as a clone of the Unix editor vi for the Amiga platform The first release of Vim for the Unix platform was out a year later and right away, it started to become an alternative to the vi editor ... Development Editor Nanda Nag Indexer Bhushan Pangaonkar Proofreader Chris Smith Nikhil Bangera Layouts and Illustrations Technical Editor Shantanu Zagade Ajay S Cover Designer Editorial Manager Dipali Chittar...

Ngày tải lên: 01/06/2014, 10:43

... and/or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional ... FA, Ventura JL, Casas M, Casas H, Pages T, Rama R, Ricart A, Palacios L, Viscor G: Erythropoietin acute reaction and haematological adaptations to short, intermittent hypobaric hypoxia Eur J Appl ... participation in the installation of the hypobaric chamber and annexed facilities We are also grateful to Mr Juan A Silva from Universidad de Antofagasta (Chile) by his collaboration in some data collection,...

Ngày tải lên: 18/06/2014, 15:20

... in a b us? 26 27 Le t’s take a n! rai t Trains are a fun way to travel A loud bell clangs at the train crossings! The train pulls into the station Travelers wait to get on the train A speaker ... is a great way to leave behind the places you know! t Wha like you nd? rete to p You are the chief of a rainforest village You are a polar bear roaming the North Pole tak You are a mermaid floating ... You can learn so much a m! t a museu You might see a play or watch a parade in the city Can you find these things in the pictures here? a marching band two crazy clowns a girl with a cat a giant...

Ngày tải lên: 19/06/2014, 08:20