coursebooks should have a clear role as a support for learning like teachers they mediate between the target language and the learner
Báo cáo khoa học: "Pro/con clinical debate: Life support should have a special status among therapies, and patients or their families should have a right to insist on this treatment even if it will not improve outcome" ppt
Ngày tải lên :
12/08/2014, 20:20
... making, and to a prevailing sense that patients and families have the only say and can receive almost any intervention that they insist upon However, health care providers still have an ethical ... explanation of what exactly is involved, what can and cannot be achieved, what the burdens may be, what the likelihood of achieving the goals is, what the impact on quality of life may be, and ... of disease course so that other interventions (e.g antibiotics) have time to affect an actual cure It is clear that, at a certain point, for survival the body must have the capacity to heal In...
- 3
- 244
- 0
Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx
Ngày tải lên :
11/08/2014, 03:20
... β-actin, Sense: 5'-TG GAATCCTGTGGCATCCATGAAAC -3', Antisense: 5'TAAAACGCAGCTCAGTAACAGTCCG-3'; IFNγ, Sense: 5'-AGCGGCTGACTGAACTCAGATTGTAG CTTGTACCTTTACTTCACTG-3', Antisense: 5'-GTC ACAGTTTTCA ... 3'-GUUGUGAGCGACGUUAUAA-5'(antisense) α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense) 3'-UUUCCAGAAUACCACGACAGU5'(antisense) Transmembrane domain 5'-UGUGAUGAAUAGGAGGUGAUU-3'(sense) 3'-UUACACUACUUAUCCUCCACU5'(antisense) ... 7900 HT thermal cycler (Lab Centraal B.V., Haarlem, The Netherlands) was used for all real-time RT-PCR assays Reverse transcription was conducted at 50°C for 30 min, followed by denaturation at 95°C...
- 12
- 287
- 0
Báo cáo y học: "Does serum procalcitonin have a diagnostic value in febrile adult patients presenting to the emergency department" potx
Ngày tải lên :
13/08/2014, 08:21
... that, in contrast to the etiological diagnosis of the emergency physician found in the medical chart, we observed that administration of antibiotics was not always in accordance with that diagnosis, ... adverse postoperative outcome after cardiac surgery A comparative study between coronary artery bypass graft, valve, and combined cardiac surgery Crit Care 2007, 11:R106 Christ-Crain M, Jaccard-Stolz ... emphasizing the complex issue of the prescription of antibiotics and the potential added value of biomarkers like PCT Therefore we think that the next important steps in assessing PCT diagnostic...
- 2
- 260
- 0
Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx
Ngày tải lên :
20/02/2014, 18:20
... results and the corresponding actual utterances, then they are stored in a database (referred to as an Error-Pattern-Database) In EPC, the correction is made by substituting a Correct-Part for an ... 1245(-8.5) The values inside brackets are the rate of decrease 4.3 More Applicable for a Result Having a Few Errors In EPC+SSC, the rate of decrease was 8.5%, and the decrease was obtained in all type ... prepared the StringDatabase We employed as the threshold value for the frequency of the occurrence, and 10 as the length of a string, therefore obtaining 16655 strings 3.2 Two Factors for Evaluation...
- 5
- 588
- 0
INFLUENZA VIRUS a model for learning about disease
Ngày tải lên :
15/03/2014, 12:58
... Ivanovski and Beijerinck showed that a disease in tobacco was caused by a virus Loeffler and Frosch discovered an animal virus that causes foot and- mouth disease in cattle Many years of ... Temperate phages- special DNA phages that undergo adsorption and penetration but are not replicated or released immediately Instead the viral DNA enters an inactive prophage stage Lysogeny: the ... particles, either active or inactive Obligate intracellular parasites Cannot multiply unless they invade a specific host cell and instruct its genetic and metabolic machinery to make and release new viruses...
- 59
- 1.5K
- 0
assessment in social work a guide for learning and teaching
Ngày tải lên :
26/05/2014, 23:30
... opportunities for learning about the relationship of organisations and assessment at the same time as examining the pros and cons of standard assessment tools Questions for educators • Do the learning materials ... refer to the quality and characteristics of the assessment and intervention processes and to the associated skills of the assessor Examples are as follows Social workers should learn about assessment ... prepared for a single paradigm or approach to assessment and suggests that different approaches are shaped by the teacher’s own theoretical and value stance and mediated by the level of the student’s...
- 102
- 660
- 0
Báo cáo y học: " A novel trifunctional IgG-like bispecific antibody to inhibit HIV-1 infection and enhance lysis of HIV by targeting activation of complement" ppsx
Ngày tải lên :
12/08/2014, 04:20
... mediator between the innate and adaptive immune responses, the complement system is a particular focus of these immune-evasion strategies [4-6] In human plasma, HIV immediately activates the ... YXH participated in developing the hypothesis and collaborated in writing and reviewing of the article All authors read and approved the final manuscript Acknowledgements This work was supported ... of the hypothesis would demonstrate that (anti-gp120 × anti-C3d)-Fc can bind to HIV virions and can result in an amplification of the complement activation cascade As a consequence of this action,...
- 4
- 242
- 0
A Framework for city leadership in multilevel governance settings: the comparative contexts of Italy and the UK
Ngày tải lên :
25/04/2016, 07:41
... Consequently, mayors (and members of cabinet) have substantially replaced parties in their traditional role of mediation and representation of civic interests and issues It has as emerged an ‘ask -the- mayor’ ... government and governance in the UK, civic leadership is and has been a variable concept and practice One can argue that civic leadership saw a revival in the 1980s in reaction to the increased centralization ... municipalities not have a city manager, but a general secretary (the traditional ‘warrantors’ of the legality and conformity of administrative acts) This institutional choice made by the Italian...
- 18
- 366
- 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx
Ngày tải lên :
08/03/2014, 23:20
... important to better understand these dynamics Acknowledgements Many thanks to Vijay Cuddeford for research support, Margaret Savard for editorial assistance, and Agriculture and Agrifood Canada for ... offers some additional, if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has examined relative E and GHG efficiency ... organic and conventional farms located in alpine, upland and lowland regions Notably, and rather innovatively, the authors included an estimate for GHG impacts of the estimated land use change...
- 41
- 524
- 1
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
Ngày tải lên :
16/03/2014, 05:20
... blot analysis appeared rather broad, probably because large amounts of unlabeled CFMYP and EGMYP naturally present in the gonads formed broad bands and affected the shape of the bands of the labeled ... substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The normality ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about...
- 14
- 442
- 0
Evaluating the Executive Director Your Role As a Board Member doc
Ngày tải lên :
24/03/2014, 01:20
... evaluation Check the following list to prepare for and avoid these • Procrastination The board delays the evaluation for a meeting, then another, and then another… • Accentuating only the negative ... is only as a single entity that the board has any power at all Choose an Approach To some extent, you are always evaluating the executive director, via observation at formal and informal meetings, ... submitted to the board for review and approval [at the] end of the fiscal year Assessment criteria and standards will be specified prior to the appraisal Findings will be given to the board and the chief...
- 31
- 284
- 0
báo cáo hóa học:" Enhancing the efficacy of cisplatin in ovarian cancer treatment – could arsenic have a role" potx
Ngày tải lên :
20/06/2014, 07:20
... Survival was better with platinum alone and with platinum-containing combinations [25] An additional class of drug, the taxanes, was discovered and came to play a role in the front-line armamentarium ... intraperitoneal to plasma concentrations varies from 18–20× for carboplatin and cisplatin to 120 – > 1000× for the taxanes, docetaxel and paclitaxel [41] EOC should be a good target for intraperitoneal ... between platinum-DNA adduct formation and removal and cisplatin cytotoxicity in cisplatin-sensitive and -resistant human ovarian cancer cells 1994, 54:5911-5916 Masuda H, Tanaka T, Matsuda H, et al.:...
- 7
- 504
- 0
Báo cáo hóa học: "ZnSe nanotrenches: formation mechanism and its role as a 1D template" potx
Ngày tải lên :
21/06/2014, 04:20
... section of the nanotrenches has a V shape in general, while that of the AuZnδ NPs has a V shape for the portion embedded in the ZnSe layer and an arc shape for the portion above the trench body The ... noncontacted portion of the AuZnδ catalyst droplets shares the same cause as well since it is well known that a spherical shape for a non-contacted nanodroplet has the smallest surface area so as ... phenomenological model and significantly contributed to the drafting of this manuscript All the authors have read and approved the final manuscript Competing interests The authors declare that they have...
- 6
- 419
- 0
Báo cáo khoa học: "Does the surgeon still have a role to play in the diagnosis and management of lymphomas?" docx
Ngày tải lên :
09/08/2014, 07:21
... lymphomas, one of the important roles of FNAC is the exclusion of metastatic squamous carcinoma as this requires an alternative therapeutic approach There is a question as to the accuracy of FNAC ... to allow accurate cellular classification of the lymphomas Fine needle aspiration cytology (FNAC) was developed at the turn of the century and has become a popular diagnostic tool as it is rapid, ... in the diagnosis of lymphomas as the tumours often contain malignant and reactive elements and the FNAC may only have sampled the reactive regions leading to false negative results Another disadvantage...
- 4
- 435
- 0
Báo cáo khoa học: "Do statins have a role in preventing or treating sepsis" pptx
Ngày tải lên :
12/08/2014, 23:21
... hemodynamic alterations were already evident, survival time was again significantly extended in treated Available online http://ccforum.com/content/10/1/113 animals and hemodynamic status was markedly ... dysfunction Data in humans are lacking In a prospective observational cohort study [18] it was found that prior statin therapy is associated with a decreased rate of severe sepsis and intensive care unit ... models indicate that statins profoundly affect NO availability [5,12-14] Specifically, in a rat pretreatment model simvastatin decreased NO overproduction and reverted the impaired vascular responsiveness...
- 3
- 260
- 0
Báo cáo y học: " Pro/Con Debate: Does recombinant factor VIIa have a role to play in the treatment of patients with acute nontraumatic hemorrhage" ppt
Ngày tải lên :
12/08/2014, 23:24
... warranted but also potentially beneficial and life saving Con: Recombinant FVIIa is not a cure for all bleeding Sandro Scarpelini and Sandro Rizoli We understand the clinical scenario and debate ... Administration MedWatch database [10] described 151 complications associated with off-label use of FVIIa, the majority occurring in trauma patients However, MedWatch is a database for voluntary ... and renal failure as well as multiple organ dysfunction FVIIa has efficacy in restoring hemostasis Additionally, early administration — before the development of acidosis, hypothermia, and subsequent...
- 4
- 304
- 0
Báo cáo y học: "Natural antisense transcripts with coding capacity in Arabidopsis may have a regulatory role that is not linked to double-stranded RNA degradation" ppt
Ngày tải lên :
14/08/2014, 14:21
... Jotham J, May S: NASCArrays: a repository for microarray data generated by NASC's transcriptomics service Nucleic Acid Res 2004:D575-D577 NASCA Arrays: Affymetrix ATH1 arrays database [http:// affymetrix.arabidopsis.info/narrays/experimentbrowse.pl] ... thaliana A comparison of the arrangements of overlapping gene pairs in Arabidopsis A comparison of the arrangements of overlapping gene pairs in Arabidopsis thaliana A and A' label the start and end ... sense-antisense overlap and expression, which should provide a basis for the selection of individual candidate loci for a detailed molecular analysis of the different dsRNA pathways Materials and...
- 10
- 234
- 0
Natural botanical products have a long history in the world and are featured in using a complex
Ngày tải lên :
03/11/2012, 09:54
... 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm3) = d2 x D/2, where d and D were the shortest and the ... hormone-responsive and hormone-refractory prostate carcinoma cells: mechanistic studies Int J Oncol 2002, 20:681-9 Yasukawa K, Ikeya Y, Mitsuhashi H, Iwasaki M, Aburada M, Nakagawa S, Takeuchi M, Takido M ... PCNA-positive cells per field [10] The same approach was adopted for measuring apoptosis and angiogenesis in the tumors Assessment of angiogenesis Microvessel density was assessed by immunostaining...
- 9
- 712
- 0