costs and benefits of obtaining a rating

Costs and benefits of business government relations an explorative study on a firm¿s perceived influence on law and regulation in transition economies

Costs and benefits of business government relations an explorative study on a firm¿s perceived influence on law and regulation in transition economies

... Republic, Latvia, Lithuania, Moldova, Poland, Romania, Russian Federation, Serbia and Montenegro, Slovenia, Tajikistan, Ukraine, and Uzbekistan After dropping observations with meaningless values and ... Europe and the former Soviet Union CEE Albania, Bulgaria, Croatia, Czech Republic, FYR Macedonia, Hungary, Poland, Romania, Slovak Republic, Slovenia Baltics Estonia, Latvia, Lithuania CIS Armenia, ... province, each town and each regional industry has its own yearly target At the end of each year, provincial, township and regional industrial leaders’ achievements are evaluated against the targets...

Ngày tải lên: 04/10/2015, 08:00

51 314 0
ecstasy the complete guide a comprehensive look at the risks and benefits of mdma

ecstasy the complete guide a comprehensive look at the risks and benefits of mdma

... and Australia, weekly raves attract tens of thousands of revelers, and the majority of those in attendance are specifically seeking out Ecstasy Even India is experiencing a significant increase ... discovered and added to the armamentarium Therapists had found a way to make painful psychotherapy easier and faster MDMA had been used for over a decade as an adjunct to psychotherapy when, in ... recommendation to stay cool at a rave, take plenty of breaks, and drink a moderate amount of water Clinical research and human studies are essential in helping us learn more about minimizing the dangers...

Ngày tải lên: 03/07/2014, 16:07

462 763 1
Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: A cost effectiveness study" pdf

Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: A cost effectiveness study" pdf

... The therapeutic approach for symptoms of schizophrenia is mainly based around pharmaceutical treatment Atypical antipsychotics could offer particular advantages over typical antipsychotics and more ... schizophrenia and acute exacerbation, olanzapine comparator Risperidone week study, patients with schizophrenia or schizoaffective disorder and acute exacerbation, aripiprazole comparator Olanzapine ... therapeutic area of schizophrenia is vast and growing rapidly, and was helpful in developing a solid and definitive model Information that was not available in the literature was obtained from clinical...

Ngày tải lên: 08/08/2014, 23:21

12 479 0
Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: a cost effectiveness study" ppsx

Báo cáo y học: "Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia in Greece: a cost effectiveness study" ppsx

... Annals of General Psychiatry 2009, 8:15 http://www.annals-general-psychiatry.com/content/8/1/15 Table 1: Mean annual number of stable days and cost per patient by pharmaceutical treatment Paliperidone ... Ollandezos M, Athanasakis K, Papanicolaou S, Kyriopoulos I: Costs and effects of paliperidone extended release compared with alternative oral antipsychotic agents in patients with schizophrenia ... there was an error with the values listed for Ziprasidone and Aripiprazole in Table Ten Table Ten should therefore appear as shown in this correction (Table 1) References Geitona M, Kousoulakou...

Ngày tải lên: 08/08/2014, 23:21

2 372 0
Tài liệu Michael Hutchison & Kathleen Mcdill - Determinants, Costs, And Duration Of Bank Sector DistressPdf doc

Tài liệu Michael Hutchison & Kathleen Mcdill - Determinants, Costs, And Duration Of Bank Sector DistressPdf doc

... Chapter 4: “Financial Crises: Characteristics and Indicators of Vulnerability” Jacklin, Charles and Sudipto Bhattacharya (1988): “Distinguishing Panics and Information Base Bank Runs: Welfare and ... deposit insurance (increasing moral hazard) and low values of a “law and order” index (a proxy for a weaker regulatory and supervisory structure) also appear to be important institutional characteristics ... oftentimes arise in times of rapid financial liberalization and greater market competition, when banks are taking on new and unfamiliar risks on both the asset and liability side of balance sheets Weak...

Ngày tải lên: 10/12/2013, 10:15

29 469 0
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

... CGTases; yellow, acarviose transferase; pink, maltogenic a- amylase; blue, a- amylases from Bacillus and actinomycetes; light blue, a- amylases from fungi and yeast; green, maltotetraohydrolases and ... the a- amylase family, this module has been recognized in enzymes having six of the almost 30 specificities: a- amylase, maltotetraohydrolase, maltopentaohydrolase, maltogenic a- amylase, CGTase, and ... generally as the SBD-containing hydrolases (mainly a- amylases, but generally classified as EC 3.2.1.x) and transglycosidases (mainly CGTases, but classified as EC 2.4.1.x), and with a noticeable small...

Ngày tải lên: 08/03/2014, 08:20

11 616 0
Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

... [28] and PROCHECK [29] In each case, the stereochemical quality and the Ramachandran [30] scores were good and similar to that of the template Docking of Pi4 on rat Kv1.2 channel The experimental ... bioassays, we tested sPi4 rather than its natural counterpart as the latter is present in too low abundance in the venom of scorpion P imperator to allow a detailed analysis of its structural and ... (2000) Chemical synthesis and characterization of maurocalcine, a scorpion toxin that activates Ca2+ release channel/ryanodine receptors FEBS Lett 469, 179–185 Mosbah, A. , Kharrat, R., Fajloun, Z.,...

Ngày tải lên: 17/03/2014, 10:20

10 503 0
Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx

Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx

... Substrate VanXYCa D59S D5 9A VanXYCa D59S D5 9A D-Ala-D-Ala a D-Ala-D-Ala D-Ala-D-Ala UDP-MurNAc-pentapeptide[Ala] UDP-MurNAc-pentapeptide[Ala] UDP-MurNAc-pentapeptide[Ala] Km (mM) kcat (s)1) kcat/Km ... as follows; Pfu polymerase (Stratagene) was used to amplify vanXYC using pAT704 as template with primers A (5¢-GCTAGGTCTCAATGAAC ACATTACAATT-3¢) and B (5¢-TATGGAATTCTCATG CGAACTGCCTCA-3¢) that ... Lessard, I .A. D & Walsh, C.T (1999) Mutational analysis of active-site residues of the enterococcal D-Ala-D-Ala dipeptidase VanX and comparison with Escherichia coli D-Ala-D-Ala ligase and D-Ala-D-Ala...

Ngày tải lên: 18/03/2014, 01:20

7 414 0
Determinants and Impact of Sovereign Credit Ratings ppt

Determinants and Impact of Sovereign Credit Ratings ppt

... Aa2 Aaa Aa1 Aa1 B1 Aa2 Baa1 A3 Baa3 Baal Aa1 Aa2 Aaa Aaa Baa3 A3 Ba1 A2 Baa3 Baa3 Aa2 A1 Aaa A1 Aaa A1 A2 Ba2 Aaa Aa2 Aa1 B1 Ba2 Baa3 A1 Aa2 Baa3 Baa3 Aa2 Aa3 Aaa Aa3 A2 Ba3 Aaa Aaa Ba1 Ba2 Sources: ... Standard and Poor’s Standard and Poor’s Rating BBAA AAA AA+ AA B+ AA+ ABBB BBBBBB+ AA+ AAAAA AAA BBBA BB+ A BB+ BBB AA AA AAA AAAAA A+ A BB AAA AA AAA B+ BB BB AAAAA BB+ BB AA AA+ AAA AA+ A B+ ... INVESTMENT-GRADE RATINGS Moody’s Standard and Poor’s Highest quality Aaa AAA High quality Aa1 Aa2 Aa3 AA+ AA AA- Strong payment capacity A1 A2 A3 A+ A A- Adequate payment capacity Baa1 Baa2 Baa3 BBB+...

Ngày tải lên: 22/03/2014, 18:20

18 471 0
Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

... pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢ b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢ c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ and 5¢-T ... produce a PCR product of 513 bp containing the transmembrane domain: 5¢-CATCC ATAGCAGATAACAGTC-3¢ (forward) and 5¢-TCCCA AAGCTCATGTCATAAG-3¢ (reverse) corresponding to amino-acid residues S(123)SIADNSL(130) ... poly (A) signals [A( 1259)TAAA and A( 1430)ATTAAA] giving rise to poly (A) tails were observed by PCR-screening of the bovine mammary gland cDNA library The N-terminal amino-acid sequencing of purified...

Ngày tải lên: 24/03/2014, 04:21

9 614 0
Credit Reporting Customer Payment Data: Impact on Customer Payment Behavior and Furnisher Costs and Benefits doc

Credit Reporting Customer Payment Data: Impact on Customer Payment Behavior and Furnisher Costs and Benefits doc

... Experian; Clark Abrahams of SAS; Paul Mara, Paul DeSaulniers and Steven Emmert of LexisNexis; Jennifer Tescher and Arjan Schutte of CSFI; Gwendolyn Robinson and Windy Oliver of GE; Carmen Hearn of ... Payment Data: Impact on Customer Payment Behavior and Furnisher Costs and Benefits b Overall Costs, Benefits, and Satisfaction Of course, the above responses speak to the relative benefits accrued ... Customer Payment Data: Impact on Customer Payment Behavior and Furnisher Costs and Benefits payments and defaults Reorganizing its account management has allowed Nicor Gas to decrease its net bad debt...

Ngày tải lên: 29/03/2014, 06:21

70 317 0
Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx

Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx

... oleic acid [2] The complex was named HAMLET and was defined as a complex between partially unfolded a- lactalbumin and oleic acid Human a- lactalbumin is a globular 14.2 kDa milk protein (123 amino acids), ... side chains of asparagines 82, 84, 87 and 88 and lysine 79 [14] The a- helical domain contains three major ahelical (amino acids 5–11, 23–34 and 86–98) and two short 310-helical domains The smaller ... Hospital Foundation, Royal Physiographic Society, Anna-Lisa, Sven-Erik Lundgren Foundation, Knut and Alice Wallenberg Foundation, Inga-Britt and Arne Lundbergs Foundation and the John and Augusta...

Ngày tải lên: 29/03/2014, 21:20

12 526 0
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

... GTTTGATAACAAGGCTTGCACCAAGG CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC ... template opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC GTTTGATAACAAGGCTTGCACCAAGG ... (Table ) Loop (9–12) and loop (18–23) create a b-turn A characteristic of the PAF loop regions is the recurring asparagine–aspartate or aspartate–asparagine (Asn18– Asp19, Asp32–Asn33, Asp39–Asn40)...

Ngày tải lên: 29/03/2014, 23:20

16 409 0
Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

... Giancola C & Graziano G (1993) THESEUS: a new software package for the handling and analysis of thermal denaturation data of biological macromolecules J Thermal Anal 38, 2779–2790 37 Kraulis PJ (1991) ... S rather than that of a mammalian crystallin such as cS-crystallin, a qualitative, indirect indication of a closer structural relationship between geodin and protein S Geodin also displays a single ... bc-crystallin superfamily Geodin is a monomeric, two-domain protein, made up of b strands apparently folded in Greek-key motifs, just as its mammalian, amphibian and bacterial homologues Of particular...

Ngày tải lên: 30/03/2014, 15:20

13 442 0
Báo cáo khoa học nông nghiệp " Poor and forest-dependent communities in two communes in Cho Don District, Bac Kan Province are empowered to sustainable manage allocated forests and equitably share costs and benefits " pdf

Báo cáo khoa học nông nghiệp " Poor and forest-dependent communities in two communes in Cho Don District, Bac Kan Province are empowered to sustainable manage allocated forests and equitably share costs and benefits " pdf

... land managed by Commune People's Committee: Mainly is bare land after slash and burn, far from villages and is commune grazing area of the villages Protection forest allocated to households: Mainly ... forest and forest land allocated to households: Mainly are forests generated after slash and burn covered by generated trees, with low volume and low economic value Production forest and forest land ... group regulation and action plan, then local authorities approved the groups and group regulation and action plan It is needed to attract the participation from all households in the village during...

Ngày tải lên: 21/06/2014, 04:20

4 408 0
Báo cáo hóa học: " Research Article Costs and Advantages of Object-Based Image Coding with Shape-Adaptive Wavelet Transform" ppt

Báo cáo hóa học: " Research Article Costs and Advantages of Object-Based Image Coding with Shape-Adaptive Wavelet Transform" ppt

... transform, dashed lines are for actual object-based coding (ii) natural images from the USC database; (iii) natural textures from the Brodatz database, also available at [29] Some examples are ... 1063–1068, 2001 Marco Cagnazzo et al [14] A Said and W A Pearlman, A new, fast, and efficient image codec based on set partitioning in hierarchical trees,” IEEE Transactions on Circuits and Systems ... circumstances In this work, we focus on a wavelet-based shape-adaptive coding algorithm The main coding tools are the shapeadaptive wavelet transform (SA-WT) proposed by S Li and W Li [10], and a shape-adaptive...

Ngày tải lên: 22/06/2014, 22:20

13 312 0
protecting legitimate rights and benefits of the juvenile according to criminal procedure legislations of vietnam

protecting legitimate rights and benefits of the juvenile according to criminal procedure legislations of vietnam

... Examining Board at Academy Level, meeting at the Graduate Academy of Social Sciences At , on / /2014 The thesis can be accessed at the National Library and the Library of the Graduate Academy of ... legitimate rights and benefits of the juvenile are also protected through other family and social institutions, namely the participation of agencies, organization, families in handling criminal cases ... lack of awareness of the juvenile and their family 3.2 CURRENT STATUS OF ORGANIZATION AND OPERATION OF PROCEDURES CONDUCTING AGENCIES IN HANDLING CRIMINAL CASES RELATED TO THE JUVENILE This part...

Ngày tải lên: 19/07/2014, 08:52

29 320 0
Báo cáo khoa học: "Alternative low doses and routes of administering a prostaglandin F2α analogue to induce luteolysis in Nelore cows" ppt

Báo cáo khoa học: "Alternative low doses and routes of administering a prostaglandin F2α analogue to induce luteolysis in Nelore cows" ppt

... gnirapmoc ,ahpla2F nidnalgatsorp htiw surtse dellortnoc ro larutan a retfa elttac ubeZ ni lairt ytilitreF R orreiF-orravaN ,A uaetahcuD ,SC anilaG ,C ravidnaL 61 4991 ,ateloG ,snoitacilbuP yranireteV ... noitanimesni laicifitrA JM sdleiF ,CA kcinraW ,RD nidraH 21 917-517 ,75 ,5002 cetooZ teV deM sarB qrA anivob aemêf ad latineg oãgró od asonev arutetiuqraoignA DJ seãramiuG ,RAT aluaP ,CAC sednanreF ... slamina mraf ni pihsnoitaler nairavoretu cimetsys susrev lacoL JO rehtniG a 012-102 ,22 ,8991 laminA oãçudorpeR ed arielisarB atsiveR riG a ar ad sacav me oãçaluvo ad oãçazinorcnis e ralucilof acimâniD...

Ngày tải lên: 07/08/2014, 18:21

4 223 0
Báo cáo toán học: "the complexity of obtaining a distance-balanced graph" pptx

Báo cáo toán học: "the complexity of obtaining a distance-balanced graph" pptx

... We add a vertex z to H and put edges between z and each vertex of B We put an edge between each vertex of B and C We put an edge between each vertex of A and V (G) ∪ V (G ) We make a maximal matching ... is based in the theory of b-matchings and a simple characterization of (strongly) distance-balanced graphs of diameter In contrast, we show in Section that the problems Dbea and Strong-dbea are ... the area of facility location problems [4] because the median of a graph comprises of vertices that have a minimal sum of distances to all other vertices They are also useful in mathematical chemistry...

Ngày tải lên: 08/08/2014, 12:23

10 206 0
w