correlation between collocations and l2 writing proficiency

... Informative Coverage (IC): S2 and S9; Informative Relevance (IRV): S3 and S8; and Informative Redundancy (IRD): S4 and S7 Results 4.1 Correlation between Human Evaluation and Original ROUGE Score ... both by humans and the automatic metrics 4.2 Impacts of Disfluencies on Correlation Table shows the correlation results between ROUGE (R-SU4) and human evaluation on the original and cleaned up ... speaker information on the correlation between R-SU4 and human evaluation Conclusion and Future Work In this paper, we have made a first attempt to systematically investigate the correlation of automatic...

Ngày tải lên: 17/03/2014, 02:20

... the Soret band is a consequence of R fi Ttransitionanditreflectstheinteractionbetweena1 and b1 subunits It may be due to tertiary structural changes in regions including aromatic residues and it may ... HbI and HbIV: iron(II)-HbI and met-HbI induce a 23.2 and 50.1% reduction of the peak intensity, respectively, when compared with the peak of the buffer Iron(II)-HbIV and metHbIV induce a 35.8 and ... in ligand affinity) in a fish hemoglobin, exhibiting the Root effect [1,2,34] Comparison between iron(II)-HbIV and met-HbIV at pH 7.8 in the regions of the L-band (about 260 nm), 280– 290 nm and...

Ngày tải lên: 23/03/2014, 12:20

... in table and Seeds aqueous extract contained the highest quantities of both flavonoids and tannins (21.12% and 17.45% respectively) The leaves extract had lower amounts of flavonoids and tannins ... (table 3) Page of Seeds and leaves aqueous extract displayed remarkable inhibition over 50% (95% and 87%, respectively) at 100 μg/ml against BuChE and with IC50 0.74 and 0.81 μg/ ml Roots aqueous ... key pathogenic role in the disease [44] Thus, we can establish a correlation between the antioxidant and antiBuChE capacities and quantity of these phenolic components Curiously, the roots aqueous...

Ngày tải lên: 12/08/2014, 17:20

... (2014) 1707e1712 complex and more interesting for the variation of switching properties From this point of view, in this study, we reported a correlation between crystallinity and switching behavior ... 730 cmÀ1, 954 cmÀ1 and 1109 cmÀ1 The annealed WO3 films at 300  C have bands at 621 cmÀ1, 730 cmÀ1, 954 cmÀ1 and 1109 cm-1 When the WO3 films were annealed up to 600  C, bands are found at 621 ... cmÀ1, 866 cmÀ1, 954 cmÀ1 and 1109 cmÀ1 The number of bands shows that the post-annealing treatment strongly affected the structure of WO3 thin film The bands at 621 cmÀ1 and 730 cmÀ1 exist in all...

Ngày tải lên: 16/12/2017, 03:53

... Department have to complete the Writing skill is taught in four semesters from Writing and about Sentence writing to Writing about Paragraph writing and Writing about Essay Writing is designed for the ... markers in L1 and L2, very few have examined the use of these discourse markers used in L2 only and in argumentative essays In addition, the relationship between the use of DMs and writing quality ... comparing research into first and second language writing, and concluded that L2 writing is strategically, rhetorically and linguistically different in important ways from L1 writing The differences...

Ngày tải lên: 02/03/2015, 14:26

... Department have to complete the Writing skill is taught in four semesters from Writing and about Sentence writing to Writing about Paragraph writing and Writing about Essay Writing is designed for the ... III.1.3 Correlation between the use of discourse markers and quality of argumentative writing essays It is crystal clear that there was no correlation between frequency of use of discourse markers and ... brainstorming and outlining, writing, and editing This course aims at equipping students with fundamental understanding of the essay first, and then supplying them with practice tasks in writing different...

Ngày tải lên: 10/08/2015, 19:50

... emerging understanding of what is required in written academic discourse Copywrite vanDommelen2008 Gen1.5MakingConnectionsbetween Speaking and Writing References 4/5/08 References Destandau, Nathalie ... the written and oral story; write a self-reflection about what they have learned from telling a story, writing a story, and writing a report for an academic audience where to begin and had so ... Gen1.5MakingConnectionsbetween Speaking and Writing 4/5/08 “Loan is an eye and ear learner that uses both “Fernando learns better by eye learning He of her learning...

Ngày tải lên: 26/10/2013, 19:15

... types of literature: on the relationship between L1 and L2 reading skills; L1 and L2 writing skills; L1 reading and writing skills; and L2 reading and writing skills Cognitive Functions Multiple ... Correlations for L1 and L2 Reading and Writing Assessments Variables All Levels L1 reading - L2 reading r = 258* L1 writing - L2 writing r = 325** L1 reading - L1 writing r = 080 L2 reading - L2 writing ... in the U.S., L2 language proficiency, L1 and L2 educational level, and L1 and L2 reading and writing assessments The researchers compared two language groups, Japanese and Chinese, and the participants...

Ngày tải lên: 24/02/2014, 18:20

... Backbone H bonds N- and C-terminals N-terminus and bF Helix and C terminus bF and C terminus Within helix (C-terminal part) Helix (C-term.) and bJ bG and bH bG and bJ bK and bL Within helix 13 ... between bL and bK shown in Fig 4B During this process formation of new H bonds between Thr375(OG1) (from helix 13 that is sequentially situated between bK and bL) and Gly337(N), as well as between ... (Tm) and calorimetric heats (Qt) of thermal transitions of pig muscle and yeast PGKs Tm and Qt values are given in °C and kcalỈmol)1, respectively Tm,cal and Tm,fluor were determined by DSC and...

Ngày tải lên: 16/03/2014, 18:20

... that intercalation and external binding of ligand with DNA, characterized by the parameter r (the number of mol of ligand per mol of base pairs), depend on the ratio of DNA and ligand concentrations ... melting of DNA and its complexes with ligands may be calculated from the general thermodynamic relation: DG ẳ DH TDS 4ị The thermostabilities of DNA and its complexes with ligands were investigated ... complexation, calculated per mol of ligand at r = 0.33 (ratio of moles of bound ligand to moles of base pairs) Values are mean ± average deviation Sample between structure and activity of the drugs It...

Ngày tải lên: 31/03/2014, 07:20

... No statistical correlations were observed between p53 and MDM2 expression in HCC (P = 0.058) and between p21/WAF1 and MDM2 expression in HCC (P = 0.431) Interestingly, statistical correlations ... WAF1 and MDM2 were associated with survival in patients with HCC Statistically significant correlation between p53, p21/ WAF1, and MDM2 expression in HCC tissues We calculated the correlation between ... correlation between p53, p21/WAF1, and MDM2 expression in 181 HCC tissues by Spearman correlation analysis (Table 1) Statistical correlation was observed between p53 and p21/WAF1 expression in HCC...

Ngày tải lên: 18/06/2014, 15:20

... intermediate PvL, and 61.8% (21/34) of subjects with a high PvL (Table 1) A significant difference in detection of the G232A mutation was found between subjects with high and low PvLs and between those ... (39) (5' CCCAAGCTTGACAATGACCATGAGC 3') and HFL2 (782) (5'CCCGAATTCCAACTGTGTACTAAATTTC 3') and in conditions as previously described [36] Complementary DNA strands from each amplicon were directly ... conducted to determine if a correlation exist between the frequency of mutations and PvLs These analyses revealed two relevant G232A mutation within the TRE-1 region and an A184G mutation within...

Ngày tải lên: 18/06/2014, 18:20

... cross -correlation coefficient between heart rate and blood pressure and whose frequency components are limited to the Mayer wave-related band, is capable of assessing VIMS On the other hand, an ... trial, ECG and finger photo-plethysmogram signals were measured and recorded with a handmade Mayer-wave analyzer [16] The resolution of A/D converter and the sampling rate are 12 bit and kHz, respectively ... decreased while watching the video and there was significant difference between the two groups both at Part-2 and Part-3 (t-test, p < 0.05) In addition, between Day1 and Day3, there was a delay in...

Ngày tải lên: 19/06/2014, 10:20

... Figure and Load and genetic parameters in the two groups of patient (SVR and TF group) and at two time points (E, prior therapy Viral Load and genetic parameters in the two groups of patient (SVR and ... and Viral load at baseline and were significantly different between SVR and TF group None of these comparison were significantly different (P > 0.05, data not shown) [49,50] Clonal analysis and ... control The mean time between the E sample and the baseline sample, hence B, was 34 weeks (SEM ± 10) for the SVR group and 24 weeks (SEM ± 0) for the TF group (Table 2) At E and B time points the...

Ngày tải lên: 20/06/2014, 01:20

... stroke [22] and arthritis [23] PD severity was assessed using UPDRS ADL and motor sub-scores (UPDRS II and III) [11], the Hoehn and Yahr Score (H+Y) [24], and the Schwab and England Disability ... by dividing by standard deviations in changes) and rescaled change in UPDRS-III scores (rho = 0.25, P = 0.045), Schwab and England scores (rho = -0.38, P = 0.003), and Hoehn and Yahr scores (rho ... relationship between change in HUI-III scores and UPRDS III scores using the approach of Fitzpatrick et al [4], with calculation of changes between first and last measurements for both scores, and rescaling...

Ngày tải lên: 20/06/2014, 16:20

... nanotubes and Mg-doped GaN thin film has been used to unreveal the defect-related broad visible emission mechanism Transmission electron microscope (TEM), cathodo- and electroluminescence (CL and EL) ... (e) Figure CL spectra of ZnO nanorods and nanotubes (a) Room temperature CL spectra of ZnO nanorods (black) and nanotubes (red) (b, d) SEM images of the rods and tubes with their corresponding monochromatic ... through the transition between the deep acceptors and deep donors In addition, one could expect the activation of the defect states discussed above by the UV emission and the re-absorbance in...

Ngày tải lên: 21/06/2014, 00:20

... kinetic and thermodynamic correlation between O2 consumption and ATP synthesis only occur when the mitochondrial membrane is maximally reduced and/ or protonated II The rates of O2 consumption and ... strict kinetic and stoichiometric correlation between ATP synthesis and O2 uptake only exists during the initial phase of the entire process of oxidative phosphorylation The standard reaction ... the O2 electrode and its reference The output of both the oxygen electrode and luminometer were suitably modified by changing the amperage and/ or the voltage and fed into a KIPP and ZONEN multi-channel...

Ngày tải lên: 08/08/2014, 17:20

... rank order correlation for data not normally distributed, there was a significant correlation between skin test score and RAST score (r = 0.346, p = 042, power = 0.626) but no correlation between ... lower RAST scores and in the middle range of skin test scores There was no correlation between skin test reactivity and time since reaction (r = 0.18, p = 294) or RAST score and time since reaction ... with nut allergy, Clark and Ewan5 found 66 Allergy, Asthma, and Clinical Immunology / Volume 2, Number 2, Summer 2006 no correlation between skin-prick test wheal size and the graded severity...

Ngày tải lên: 08/08/2014, 21:20

... cartilage (between the arrows) and the tissue was faintly stained and the plug was well stained (c) At 24 weeks postoperatively no reparative tissue covered the plug (between the arrows) and the ... (P < 0.05) between the sham and experimental sites at 4, 12 and 24 weeks postoperatively (not indicated in the graph) the differences in signal duration between the sides were 0.2 and 0.3 µs, ... Fig 8c) and that for 'cartilage cells' (P = 0.0499, r = -0.30; Fig 8d), but the correlation was not significant for 'staining' or 'tidemark' The correlations between signal duration and the scores...

Ngày tải lên: 09/08/2014, 01:24