controlling+the+names+used+in+a+strongly+typed+dataset

Tài liệu Controlling the Names Used in a Strongly Typed DataSet pdf

Tài liệu Controlling the Names Used in a Strongly Typed DataSet pdf

... name Annotatio n DataTable TableNameDataTable typedPlural DataTable methods NewTableNameRowAddTableNameRowDeleteTableNa meRow typedName DataRowCollect ion TableName typedPlural DataRow TableNameRow ... typed DataSet and the default names and available annotations for each. Table 2-18. Default values and available annotations for elements of strongly typed DataSet objects Element Default name ... used. In either case, data is loaded into the DataSet and the collections of rows and columns in the DataSet are iterated over to display the data and to demonstrate the effect of the schema annotations....

Ngày tải lên: 24/12/2013, 05:15

5 390 0
Tài liệu Replacing Null Values in a Strongly Typed DataSet ppt

Tài liệu Replacing Null Values in a Strongly Typed DataSet ppt

... Typed DataSet Problem When a column in a database has a null value, you want the value in the DataSet to be a string indicating that no value is available. Solution Use annotations in the ... </xs:schema> The sample code creates a strongly typed DataSet based on the Categories table in Northwind. The user specifies whether the one based on the default or annotated schema file is used. ... is used. In either case, data is loaded into the DataSet. A row is added to the Categories table with a Description value of null. The data in the table is written to the text box on the form...

Ngày tải lên: 14/12/2013, 18:16

4 339 0
Tài liệu Modifying Data Using a Strongly Typed DataSet pptx

Tài liệu Modifying Data Using a Strongly Typed DataSet pptx

... Using a Strongly Typed DataSet In Chapter 10 , you saw how to create and use a strongly typed DataSet class named MyDataSet. You can use objects of this class to represent the Customers table ... table and rows from that table. In this section, you'll see how to modify data using a strongly typed object of the MyDataSet class. Note One of the features of a strongly typed DataSet ... object allows you to read a column value using a property with the same name as the column. For example, to read the CustomerID of a column you can use myDataRow.CustomerID rather than myDataRow["CustomerID"]....

Ngày tải lên: 24/12/2013, 01:17

3 299 0
Tài liệu Creating a Strongly Typed DataSet pdf

Tài liệu Creating a Strongly Typed DataSet pdf

... typed DataSet class contains, in addition to a single class extending the DataSet class, three classes for each table in the DataSet extending each of the DataTable, DataRow, and DataRowChangeEvent ... typed DataSet. codeNamespace The target namespace for the typed DataSet. codeGenerator A class capable of dynamically rendering source code in a specific language and used to create the typed ... static void Generate (DataSet dataSet, CodeNamespace codeNamespace, ICodeGenerator codeGenerator); The arguments of the method are: DataSet The DataSet used to specify the schema for the typed...

Ngày tải lên: 21/01/2014, 11:20

5 324 0
Tài liệu Reading a Column Value Using Strongly Typed DataSet Classes pptx

Tài liệu Reading a Column Value Using Strongly Typed DataSet Classes pptx

... such as Reading a Column Value Using Strongly Typed DataSet Classes A strongly typed DataSet object allows you read a column value using a property with the same name as the column. For example, ... directory to another directory and using that project as your starting point. Creating a Strongly Typed DataSet Class In this section, you'll create a strongly typed DataSet class that is used ... System.Data.SqlClient.SqlDataAdapter mySqlDataAdapter = new System.Data.SqlClient.SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; MyDataSet myDataSet = new MyDataSet(); sqlConnection1.Open();...

Ngày tải lên: 21/01/2014, 07:20

7 288 0
Tài liệu Limit the Data Displayed in a Bound List Box doc

Tài liệu Limit the Data Displayed in a Bound List Box doc

... contained within the OleDbDataAdapter control will query against to limit the data displayed in the list box. A command button will be added to allow you to call the Fill method of the OleDbDataAdapter ... parameter of the OleDBDataAdapter1, which was created by using the ? in the Select statement of 1.2 Limit the Data Displayed in a Bound List Box Even populating a list box with a couple of ... your form and start a new one as described at the beginning of the steps for this one, you have the instructions there. Otherwise, by the time you reach How-To 1.8, you will have a data entry...

Ngày tải lên: 21/01/2014, 12:20

4 323 0
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx

Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx

... operation and maintain as well (Watson and Hobson, 1989, Kadlec and Knight, 1996, Mitsch and Gosselink, 2000). They form one possible promising and feasible approach for a small scale decentralized ... precipitation processes in the soil and by microbiological degradation. Finally, the treated wastewater flows out in the bed. The wastewater is therefore not causing any odour or mosquito breeding ... translated a new insight to adjusted design parameter of constructed wetland in tropical countries for domestic wastewater treatment. The linear decreasing OM distribution to the increasing...

Ngày tải lên: 24/01/2014, 00:20

6 473 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

... C 6)12 fatty acids We purified the recombinant O-MACS protein to exam- ine whether it has an acyl-CoA synthetase activity like other MACS family proteins. The recombinant plasmid carrying either the ... 5¢-cttcctgtgtcaagtggcag-3¢ (for- ward), 5¢-gttggcagtggcattcacga-3¢ (reverse); and NeuroD 5¢-aagacgcatgaaggccaatg-3¢ (forward), 5¢-catgatgcgaatggct atcg-3¢ (reverse). Hybridization, washing, antibody reaction and ... figures. The o-macs transcripts are detected in all cell layers; supporting cell layer (s), OSN layer (n), basal layer (b), and lamina propria (lp). The o-macs mRNA was not detected in the apical (a) ...

Ngày tải lên: 08/03/2014, 02:20

10 394 0
Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf

Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf

... that bank balance sheets “remain fragile and capital buffers may still be inadequate in the face of further increases in nonperforming loans.” 3 2. Interest rate risk, exchange rate risk and ... such data are not available for Saudi Arabia. b) From 1-Jan-10 to 29-Jul-10. c) Based on banks contained in respective countries' Datastream bank indices. d) Based on banks in Datastream ... the remaining weaknesses of these economies, while inflation pressures (as RISKS AHEAD FOR THE FINANCIAL INDUSTRY IN A CHANGING INTEREST RATE ENVIRONMENT 18 OECD JOURNAL: FINANCIAL MARKET TRENDS...

Ngày tải lên: 15/03/2014, 01:20

18 384 0
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh

How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh

... speaking in general and teaching speaking in particular. In the Chapter 2, we will investigate how speaking lessons are dealt with by teachers and students in Minh Thanh secondary school in ... mother tongue if they are grouped with those having the same language, and particularly talking in small groups because they find it easier and more natural to speak their mother tongue than ... the class into two teams and play some kind of game. You could have the left side of the room against the right side, boys against girls, or each row against all the others. Competition can...

Ngày tải lên: 15/03/2014, 10:03

119 525 1
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5¢-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3¢ and 5¢-GCCTCGAGAATCAAGTGTCCCTGCACC T-3¢ (LIN-54-DN); 5¢-GCGGATCCGAGGTGGTGCCAG CTGAG-3¢,5¢-GCTCTAGAGAATGGAAGCCGTGCCT G-3¢,5¢-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3¢ and 5¢-GCCTCGAGAATCAAGTGTCCCTGCACCT-3¢ (LIN-54-DCXC);...

Ngày tải lên: 23/03/2014, 04:20

14 456 0
The Canadian Economy in a Global Setting pptx

The Canadian Economy in a Global Setting pptx

... 42 What and With Whom What and With Whom Canada Trades Canada Trades  Balance of trade – the difference between the value of exports and the value of imports  Balance of trade contains ... 58 International Economic International Economic Policy Organizations Policy Organizations  Governmental international organizations that encourage international cooperation include:  The ...  There are also informal organizations such as:  The Group of Five (Japan, Germany, Britain, France, and the U.S.) which meets to promote negotiations and coordinate economic relations among nations. ©...

Ngày tải lên: 29/03/2014, 17:20

62 483 0
LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt

LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt

... of law. In the same way, just as it is not only essential that we maintain ourselves as a liberal democratic society as an aim in itself, but, by doing so, we will ensure that we can maintain ... but also upon the justice and humanity of the law . . .’ 13 33. It may be difficult to ensure that that bargain could be maintained by entirely virtual hearings. It may be hard to maintain the ... have all played an important part in our legal history. Given the entrepreneurial nature of its lawyers, they are playing an important part today, and I am sure they will continue to play an...

Ngày tải lên: 31/03/2014, 03:20

16 468 0
A study on euphemism used in expressing the Death in English and Vietnamese

A study on euphemism used in expressing the Death in English and Vietnamese

... general in most of national languages, but another part has the strong national characteristics. In Western culture, asking others’ age, income, marital status, religious belief and political ... universal feature of language usage; all cultures typically use them to talk about things they find terrifying (e.g., war, sickness, death) because, anthropologically, "to speak a name was ... communication, for better maintaining social relationship and exchanging ideas, people have to resort to a new different kind of language, which can make distasteful ideas seem acceptable or...

Ngày tải lên: 17/03/2014, 16:19

58 1.1K 0
Xem thêm

Bạn có muốn tìm thêm với từ khóa:

w