control 3 stepper motors arduino
Sap Solutions For Governance Risk And Compliance And Grc Access Control 3 doc
... Audit Access Controls SAP GRC Access Control © SAP AG 2007, SAP Skills 2007 Conference / G3 / 37 SAP GRC Access Control 5 .3 SAP GRC Access Control branding and single launchpad for all 4 access control ... V E Y Ye s N o 1 1 3 4 5 6 9 10 11 12 15 16 17 18 19 7 8 13 14 22 23 24 25 26 20 21 29 30 27 28 2 SAP GRC Process Control: Centralized Control Management Centralized Control Management ... and manual controls System can manage – Financial Control – Operational Controls – IT Controls Controls can be monitored across multiple enterprise systems Improve controls with...
Ngày tải lên: 05/03/2014, 19:20
Sanboxie Control 3.5 - Môi trường ảo thử nghiệm phần mềm pps
Ngày tải lên: 01/08/2014, 03:20
Bài 3: Web server control
... Bài 3 WEB SERVER CONTROL 1. HTML Control Điều khiển HTML (tag HTML) trong trang ASP.Net có thể xem như những chuỗi ... thông qua tập hợp Controls của ô đó. Ví dụ: Sử dụng các điều khiển Table Màn hình khi thiết kế Xử lý sự kiện: Private Sub Page_Load(…, e … ) Handles MyBase.Load Ve_bang (3, 3) End Sub Public ... bên trong lúc thi hành, chúng ta phải thực hiện thông qua tập hợp Controls của điều khiển: Ví dụ: Dim txtSo_A As New TextBox pnl.Controls.Add(txtSo_A) Điều khiển Table Điều khiển Table thường được...
Ngày tải lên: 28/10/2013, 04:15
SIEMENS SIMATIC power controller and 3 phase stepping motors
Ngày tải lên: 21/11/2013, 13:45
Tài liệu Lesson 3: Control Statements - Selection pptx
... Tutorial by Joe Mayo, 9/2/00, updated 10/6/01 Lesson 3: Control Statements - Selection This lesson teaches you how to use C# Selection Control Statements. Its goal is to meet the following ... cases for myInt equal to 1, 2, or 3, where case 1 and case 2 will fall through and execute code for case 3: switch (myInt) { case 1: case 2: case 3: Console.WriteLine("Your ... && myInt <= 30 ) { Console.WriteLine("Your number {0} is between 21 and 30 .", myInt); } else { Console.WriteLine("Your number {0} is greater than 30 .", myInt);...
Ngày tải lên: 21/12/2013, 06:16
Tài liệu An Introduction to Intelligent and Autonomous Control-Chapter 3:Model-Based Architecture Concepts for Autonomous Systems Design and Simulation docx
... y0 w3 hc" alt=""
Ngày tải lên: 26/01/2014, 07:20
Tài liệu Project Planning and Control Part 3 pptx
... S 1 2 6 7 17 1 23 24 21 33 37 1 11 3 4 1 8 9 10 1 14 16 20 1 21 26 28 30 34 35 36 F 2 3 7 8 18 20 24 25 32 34 38 11 12 4 5 6 9 10 13 14 15 19 26 21 22 27 29 31 35 36 37 Time Dummies 6 2 3 7 2 5 19, 24, 4 3 26, 28, 30 , 33 2 3 34, 3 4 2 13, 14, 16, 17, 20, 3 1 7 8, 2 3 10 11, 16, 20, 17, 14, 3 3 7 16, 21, 23, 17, 24, 5 3 5 23, 28 5 5 2 34 , 30 , 33 6 10 10 Activity Excavate ... 14 .3 Figure 14.4 Figure 13. 7 S 1 2 6 7 17 1 23 24 21 33 37 1 11 3 4 1 8 9 10 1 14 16 20 1 21 26 28 30 34 35 36 F 2 3 7 8 18 20 24 25 32 34 38 11 12 4 5 6 9 10 13 14 15 19 26 21 22 27 29 31 35 36 37 Time Dummies 6 2 3 7 2 5 19, ... 1 234 56789101112 131 41516171819202122 23 14 - 15 13 - 14 12 - 13 11 - 12 10 - 11 1-10 8-9 7- 8 6-7 5-6 1-5 3- 4 2 -3 1-2 P N M L K J H G F E D C B A Node no. Days 12A 23B 3 4,7C 15 D 56 E 6 7, 13 F 78 G 8...
Ngày tải lên: 26/01/2014, 11:20
asg 3 motors and oads
... loads 37 1 2 3 4 5 6 7 8 9 10 11 12 M 3. 1 Three phase asynchronous motors 38 3. 2 Single-phase motors 42 3. 3 Synchronous motors 43 3.4 Direct current motors commonly named DC motors 45 3. 5 Operating ... permanent magnet motor A Fig. 13 Synchronous wound rotor motor 3. 3 Synchronous motors 3. 4 Direct current motors commonly named DC motors 3. Motors and loads 45 3 The motor rotates discontinuously. ... Single phase short circuit phase-shift rings 3. 2 Single-phase motors 3. 3 Synchronous motors 3. Motors and loads 43 3 b Universal single-phase motors Though little used in industry, this is...
Ngày tải lên: 15/02/2014, 08:37
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx
... enhancer (HS4), a region 5Â- to HS3 (5ÂHS3), the core of HS3 (HS3), a region anking HS2 and HS3 (3 ⁄ 2 flank), the core of HS2 (HS2), a region downstream of HS2 (3 HS2), and the b maj -globin gene ... b-actin [ 43] , Rex-1 [44], mouseHS4RT2 US: 5Â-GAGATCCTGCCAAGAC TCTG -3 and DS, 5Â-GGGCTGTACAGACATCTAGG -3 ; mouse5ÂHS3: US, 5 Â-GCCCCTCCTCTCATGAGCC -3 an DS, GATGGGGCAAGGGCCAAGGC -3 ; mouseHS3RT US: ... 5Â-GGACTTTCTCAGTATGA CATG -3 ; humanHS3RT: US, 5Â-CCA CCAG CTATCA GGGCCCAG- 3 and DS, 5Â-GCTGCTATGCTGTGCCTC- 3 ; human5ÂHS2: US, 5Â-TGGGGACTCGAAAATCAA AG -3 and DS, 5Â-AGTAAGAAGCAAGGGCCACA -3 ; humanHS2RT3: US,...
Ngày tải lên: 07/03/2014, 12:20
power system stability and control chuong (3)
... Installed Capacity Canada 83 China 224 Denmark 1450 India 968 Ireland 63 Italy 180 Germany 2874 Netherlands 36 3 Portugal 60 Spain 834 Sweden 150 U.K. 33 4 U.S. 1952 Other 30 4 Total 9 839 ò 2006 by Taylor ... 18.2 2 03 6=97 11.9 16 .3 167 7=96 12.5 16.5 169 7=97 13. 3 18.5 212 8=96 11.6 16.0 156 8=97 11.7 16.9 176 9=96 12.4 17.2 182 9=97 13. 6 19.0 211 10=96 17.1 23. 3 32 0 10=97 15.0 21.1 265 11=96 15 .3 20.0 ... 14.9 20 .3 256 1=97 15.8 21.2 269 2=96 16.2 22.4 290 2=97 14.7 19.0 207 3= 96 17.6 22 .3 281 3= 97 17.4 22.8 291 4=96 19.8 25.2 32 2 4=97 15.9 20.4 242 5=96 18.4 23. 1 297 5=97 15.2 19.8 236 6=96 13. 5...
Ngày tải lên: 21/03/2014, 12:11
Annex A.3 Review of Tuberculosis Infection Control ppt
... patient to patient Environmental controls are the second line of defense for preventing the spread of TB in out-patient HIV care facilities. The main environmental control is natural and mechanical ... has coughed for 2 weeks or more is a “TB suspect” for pulmonary TB. Annex A .3 Review of Tuberculosis Infection Control The presence of tubercle bacilli on a sputum smear indicates that the ... bacilli on sputum smear Not receiving adequate treatment Receiving adequate treatment for 2 -3 weeks Health care workers who may be exposed to TB should be included in a TB screening program ...
Ngày tải lên: 22/03/2014, 18:20
IEC 60534 8 3 control valve aerodynamic noise prediction method
... suivantes: i r 000 5 D f π = (38 ) = 34 3 4 2r o cf f (39 ) () () 000 5 34 3 3 p 2 g t f π = (40) NOTE 5 Dans les équations (39 ) et (40), la constante 34 3 représente la vitesse du ... close 0,10 0,20 0,15 0 ,30 0,25 0,50 0 ,31 0,60 0 ,39 0,80 0,46 1,00 Globe, 3 V-port plug Either* 0,29 0,40 0,42 0, 43 0,45 0,48 Globe, 4 V-port plug Either* 0,25 0 ,35 0 ,36 0 ,37 0 ,39 0,41 Globe, 6 V-port ... – 96 – 60 534 -8 -3 CEI:2000 = 1 2 12 p p ρ ρ = 0,27 kg/m 3 (33 ) où ρ 1 =5 ,30 kg/m 3 ; p 1 =1,0 ì 10 6 Pa; p 2 =5,0 ì 10 4 Pa. 22 2 o 4 cD m M = = 0,89 (35 ) où m =0,89...
Ngày tải lên: 04/04/2014, 11:33
iec 60534-3 industrial process control valves - dimensions
... 250 or 30 0 Class 600 (20) (187) (194) (206) 25 184 197 210 40 222 235 25 1 ‘1.5 50 254 267 286 298 31 7 33 7 (65) 80 (276) (292) (31 1) 100 35 2 36 8 39 4 150 451 4 73 508 2 ... Classe 600 L (206) 210 25 1 286 (31 1) 33 7 f 1’5 36 8 4 73 568 39 4 508 610 f 2,5 708 I 752 I 775 921 1057 1 819 972 1108 f 3, 5 Les valeurs entre parenthèses sont ... (bar) PN 40 (bar) (260) 260 (30 0) 30 0 35 0 (400) 450 I I l 35 0 480 600 (400) . 430 550 650 (500) 5 20 (600) 700 800 250 30 0 400 730 850 1100 775 900 1150 -r...
Ngày tải lên: 04/04/2014, 14:50