contrasting approaches to development and foreign debt

underhill - global financial integration thirty years on; from reform to crisis (2010)

underhill - global financial integration thirty years on; from reform to crisis (2010)

... governs and why? The making of a global anti-money laundering regime 172 eleni tsingou 10 Brazil and Argentina in the global financial system:  contrasting approaches to development and foreign debt ... first and greatest debt is to the excellence of our contributors and their loyalty and patience in sticking with the effort to send the book to press A few of the scholars who contribute to this ... we and the xiii xiv Preface contributors wondered what on earth would happen next to the financial world and to our volume As editors we chose path dependency and soldiered on We would like to...

Ngày tải lên: 01/11/2014, 19:47

376 660 0
FROM CREATIVE ACCOUNTING PRACTICES AND ENRON PHENOMENON TO THE CURRENT FINANCIAL CRISIS pptx

FROM CREATIVE ACCOUNTING PRACTICES AND ENRON PHENOMENON TO THE CURRENT FINANCIAL CRISIS pptx

... on the IFRS standards the research and development are capitalized and depreciated Standards development committees of the two agencies recognize the need to bring closer the standards, but nowadays ... first to respond to the Enron crisis Unfortunately, and sadly reminiscent of financial disasters in the 1970s and 1980s, this response will likely be viewed by investors, creditors, lawmakers and ... followers to support flexibility in the accounting field and it will act so as to restrict it It is unreasonable and difficult to suggest to the management boards of all companies to waive immediately...

Ngày tải lên: 23/03/2014, 00:20

8 696 1
Assessment and solutions to the current water source pollution in man xa craft village casting aluminum and lead in van mon, yen phong, bac ninh

Assessment and solutions to the current water source pollution in man xa craft village casting aluminum and lead in van mon, yen phong, bac ninh

... bonding the sand moulds: + The "green sand" consists of mixtures of sand, clay and moisture + The "dry sand" consists of sand and synthetic binders cured thermally or chemically The sand cores used ... been a top priority The traditional trade has also contributed greatly to the rural economy Policy of the Party and State is recovery and development of villages to facilitate economic development, ... the Laboratory of Center of natural resources and Environment Monitoring of Bac Ninh conformable to program periodically monitored environmental of the Village - Samples transportation and sample...

Ngày tải lên: 28/04/2016, 13:35

58 526 0
Vietnam’s exports to the eu Situation and recommendations.doc

Vietnam’s exports to the eu Situation and recommendations.doc

... supply and demand: Factor in great supply relative to demand will be less costly than factors in short supply relative to demand Factors proportion theory states that countries produce and export ... of the art and handicraft goods equaling to USD 19.40 million to the Federal Republic of Germany; USD 7.9 million to Belgium; USD 15.52 million to Holland; USD 17.64 million to England - 20 - ... aimed to establish a common market of agricultural and industrial goods And then they came to form a Community of European Energy Atomic (CEEA) as to control the use of energy and study of atomic...

Ngày tải lên: 27/10/2012, 16:55

35 805 3
China’s banking reform: Issues and prospects for the future

China’s banking reform: Issues and prospects for the future

... le nding and de po s it rate s Restricted b Financial liberalization (con’t) Opening up to foreign competition:  To greenfield investment due to WTO commitment – However difficult to grow organically ... in banks ’ hands thro ug h inte rbank S • o IPOs and e xpo s ure to fo re ig n rule s (HK s to c k e xc hang e ) Als • s e t quality muc h be tte r but s till po o r c o mpare d to inte rnatio ... credit quotas removed – Private ownership: joint-stock commercial banks and city commercial banks starting 1999 – Also foreign more recently with WTO commitments Restricted b Financial liberalization...

Ngày tải lên: 26/10/2013, 16:15

20 472 0
Introduction to the basic approaches and issues of Intrusion Detection

Introduction to the basic approaches and issues of Intrusion Detection

... Iincidents weekly to Sector Center Report Category incidents weekly to Sector Center How does one Owners and Operators: How does one Owners and Operators: * *Round-the-clock staffing of Sector Center ... staffing of Sector Center ever get back * *Report new Category I Iand IIIIincidents within 24 hrs to Sector Center Report new Category and incidents within 24 hrs to Sector Center to Green? to Green? ... ORANGE and INFOCON RED contingency plans Owners and Operators: Owners and Operators: * *Report new Category I,I,II, and III incidents immediately to Sector Center Report new Category II, and III...

Ngày tải lên: 04/11/2013, 13:15

34 445 0
Tài liệu Capitalize this- a guide to the proper care and feeding of capital letters doc

Tài liệu Capitalize this- a guide to the proper care and feeding of capital letters doc

... The Uses and Rules of Capital Letters Capitalize the names of family relations when they are used as substitutes for names: I went to visit my Uncle Ted and Aunt Margaret Grandma and Grandpa live ... and Grandpa live with Dad and Mom now I went with my mom and dad to visit my aunt and uncle Notice the role of the modifying pronoun here A CAPITAL IDEA! The Uses and Rules of Capital Letters ... CAPITAL IDEA! The Uses and Rules of Capital Letters Capitalize names of specific persons, places, and geographical locations My brother Charlie, who used to live in the Middle East and write books about...

Ngày tải lên: 20/12/2013, 18:15

13 659 1
iec 60076-4 power transformers - guide to the lightning impulse and switching impulse testing

iec 60076-4 power transformers - guide to the lightning impulse and switching impulse testing

... Committees undertake to apply IEC International Standards transparently to the maximum extent possible in their national and regional standards Any divergence between the IEC Standard and the corresponding ... levels, dielectric tests and external clearances in air Part 4: Guide to lightning impulse and switching impulse testing Power transformers and reactors Part 5: Ability to withstand short-circuit Part ... three- and five-limb cores to perform simultaneously testing of the phase -to- earth and phase -to- phase insulation with 1,0 p.u (per unit) and 1,5 p.u respectively The choice of winding to which...

Ngày tải lên: 25/12/2013, 10:35

132 730 11
Tài liệu The Culture That Gave Rise To The Current Financial Crisis pptx

Tài liệu The Culture That Gave Rise To The Current Financial Crisis pptx

... restoring to their principals the neglected rights of ownership of stocks, and demanding that corporate directors and managers meet their fiduciary duty to their own shareholders (4) The right to ... signal that the operator was trying to substitute theory for experience, and usually also to give to speculation the deceptive guise of investment Have not investors and security analysts ... financial arena, bestowal of wealth to traders and managers that is totally disproportionate to the value they add to investors’ wealth Indeed, the financial sector actually subtracts value from...

Ngày tải lên: 16/01/2014, 22:20

16 357 0
Tài liệu Guide to the Successful Thesis and Dissertation doc

Tài liệu Guide to the Successful Thesis and Dissertation doc

... Study, Richard Krzys and Gaston Litton 43 Guide to the Successful Thesis and Dissertation: Conception to Publication: A Handbook for Students and Faculty, James E Mauch and Jack W Birch 44 Physical ... Edition, Revised and Expanded, Elisabeth B Davis and Diane Schmidt 58 Guide to the Successful Thesis and Dissertation' A Handbook for Students and Faculty, Fourth Edition, Revised and Expanded, James ... decided to write about the “how to aspects of thesis and dissertation study and to emphasize the intellectual effort required of both students and professors This book is designed to inform and...

Ngày tải lên: 17/01/2014, 05:20

355 502 0
Environmental barriers to trade of the united states and implications for vietnam

Environmental barriers to trade of the united states and implications for vietnam

... 3.1.2.1 Cấm nhập Việt Nam cấm nhập số hàng hoá thuộc diện cần phải đảm bảo an to n công cộng, an to n môi trường an to n lao động lý liên quan đến văn hóa 3.1.2.2 Giấy phép nhập Hàng hoá nhập từ ... (2003), European Unilateralism-Environmental Trade Barriers and the Rising Threat to Prosperity through Trade Website 16 http://www.census.gov /foreign- trade/statistics/index.html 17 http://vietnamese.vietnam.usembassy.gov/ambassador.html ... http://environment-safety.com/courses/EnvManagement/envStandards.htm 44.http://vea.gov.vn/vn/khoahoccongnghe/nhanxanh/gioithieunhansinthai/Pages 45 http://www.census.gov /foreign- trade 46.http://www.customs.gov.vn/Lists/TinHoatDong...

Ngày tải lên: 06/02/2014, 20:27

25 594 0
Tài liệu REPORT TO THE PRESIDENT PREPARE AND INSPIRE: K-12 EDUCATION IN SCIENCE, TECHNOLOGY, ENGINEERING, AND MATH (STEM) FOR AMERICA’S FUTURE docx

Tài liệu REPORT TO THE PRESIDENT PREPARE AND INSPIRE: K-12 EDUCATION IN SCIENCE, TECHNOLOGY, ENGINEERING, AND MATH (STEM) FOR AMERICA’S FUTURE docx

... with, build, and adapt to technology to expand opportunities for all Americans and to ensure that the Nation’s living standards continue to rise Preparing this workforce is essential to the country’s ... potential to transform STEM education, too little attention has been paid to replication and scale-up to disseminate proven programs widely, and too little capacity at key agencies has been devoted to ... potential to transform STEM education, too little attention has been paid to replication and scale-up to disseminate proven programs widely, and too little capacity at key agencies has been devoted to...

Ngày tải lên: 12/02/2014, 19:20

142 634 1
Tài liệu THE ENCYCLOPEDIA OF HOLLYWOOD: AN A TO Z GUIDE TO THE STARS, STORIES, AND SECRETS OF HOLLYWOOD docx

Tài liệu THE ENCYCLOPEDIA OF HOLLYWOOD: AN A TO Z GUIDE TO THE STARS, STORIES, AND SECRETS OF HOLLYWOOD docx

... Teich, Lillian and Jack Goldberg, and Stephanie Tranen who took us to the movies when we were too young to take ourselves They were the first to introduce us to the images of light and shadow that ... depression due to huge debts to Herbert J Yates’s film processing company, which took over Monogram (and several other film companies) and formed Republic Pictures Meanwhile, Johnston and Carr didn’t ... Astaire was delighted to help out, thoroughly enjoying the chance to work with JUDY GARLAND The movie was a huge success, and he and Garland were scheduled to follow it up together in The Barkleys...

Ngày tải lên: 19/02/2014, 10:20

561 661 0
No Holds Barred Fighting: The Ultimate Guide to Conditioning Elite Exercises and Training for NHB Competition and Total Fitness pot

No Holds Barred Fighting: The Ultimate Guide to Conditioning Elite Exercises and Training for NHB Competition and Total Fitness pot

... waist and touch your left toes with your right hand — Count ● Back upright and fling — Count ● Bend forward and touch the toes of the right foot with the left hand — Count ● Return to upright and ... waist and remain there throughout ● Twist and touch the toes of the left foot with the right hand — Count ● Twist and touch the toes of the right foot with the left hand — Count 45 Warm-up Fore and ... have to devote to fighting technique, sparring drills and such that got you into the sport in the first place Keep in mind at all times that your job is to learn to be a better fighter, not to...

Ngày tải lên: 05/03/2014, 21:20

257 635 1
Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx

Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx

... according to Eqn (D,E) Current recordings of hEAG1 (D) and hEAG1DN channels (E) in response to test depolarizations to +50 mV (D), and to )20 and )80 mV (E) under control conditions, i.e with Ca2+-free ... TMR-labeled peptide C2, EF-hand mutations and increased the KD by about a factor of seven (to 1560 ± 190 nm compared to 223 ± 44 nm for the wild type); EF-hand mutations and resulted in a complete loss ... (left) and after (right) exposure to BODIPY FL-hCaM Dark spots indicate CaM binding The top frame marks the spots encompassing residues 1–205, the bottom frame the C-terminal residues 480–962 (B) Topology...

Ngày tải lên: 07/03/2014, 12:20

13 500 0
Export to the world market and to North America ppt

Export to the world market and to North America ppt

... Switzerland SFS Suomen Standardisoimisliitlo r.y Finnish standardisation association, Finnish standard Finland STRI The Icelandic Council for Standardization Isländische Normungsorganisation Iceland ... Transmitter Synchronous Motor Wound-Rotor Induction Motor or Induction Frequency Convertor BT Battery C Capacitor • Capacitor, General • Polarized Capacitor Shielded Capacitor CB Circuit-Breaker ... Disconnecting Device • Male Receptable Q Thyristor • NPN-Transistor • PNP-Transistor R Resistor • Adjustable Resistor • Heating Resistor • Tapped Resistor • Rheostat Shunt • Instrumental Shunt •...

Ngày tải lên: 09/03/2014, 02:20

44 459 0
www.it-ebooks.info.Instant Migration to HTML5 and CSS3 How-toDiscover how to upgrade your existing website to the latest HTML5 and CSS3 standardsDushyant KanungoBIRMINGHAM - MUMBAIwww.it-ebooks.info.Instant Migration to HTML5 and CSS3 How-toCo ppt

www.it-ebooks.info.Instant Migration to HTML5 and CSS3 How-toDiscover how to upgrade your existing website to the latest HTML5 and CSS3 standardsDushyant KanungoBIRMINGHAM - MUMBAIwww.it-ebooks.info.Instant Migration to HTML5 and CSS3 How-toCo ppt

... Migration to HTML5 and CSS3 How -to The getContext variables can be defined with different methods as well To draw a line we use the moveTo(x,y) and lineTo(x,y) methods: line.moveTo(10,10); line.lineTo(150,250); ... Migration to HTML5 and CSS3 How -to Discover how to upgrade your existing website to the latest HTML5 and CSS3 standards Dushyant Kanungo BIRMINGHAM - MUMBAI www.it-ebooks.info Instant Migration to HTML5 ... Migration to HTML5 and CSS3 How -to tries to attend to those trivial queries of the web development community in general This book guides developers or designers with examples from everyday code to help...

Ngày tải lên: 16/03/2014, 03:20

68 490 0
Báo cáo khóa học: Mycoplasma pneumoniae HPr kinase/phosphorylase Assigning functional roles to the P-loop and the HPr kinase/phosphorylase signature sequence motif doc

Báo cáo khóa học: Mycoplasma pneumoniae HPr kinase/phosphorylase Assigning functional roles to the P-loop and the HPr kinase/phosphorylase signature sequence motif doc

... and found to be very similar to those of the wild-type protein [4] (data not shown) Thus, these proteins could be used to determine ligand affinities Fluorescence measurements Binding of ATP to ... primer is underlined) and CD14 (5¢-AAGCTTAGTTAGATATCAGAGACC ATG) The PCR product was digested with NdeI and BamHI and cloned into pET3c cut with the same enzymes The wild-type and F200W forms of ... pGP204 and pGP628 using the primers SH1 (5¢-AAACCGCGGCAATGAAAAAG TTATTAGTCAAGGAG) and SH3 (5¢-AAAGGATCC GGTCTGCTACTAACACTAGGATTCATC) The PCR fragments were cut with SacII and BamHI and cloned into...

Ngày tải lên: 16/03/2014, 16:20

8 340 0
Báo cáo " Thailand’s inadequate response to the 2008 Economic Crisis: Implications for Vietnam and other countries entering the East Asian economic model " pptx

Báo cáo " Thailand’s inadequate response to the 2008 Economic Crisis: Implications for Vietnam and other countries entering the East Asian economic model " pptx

... attached to it, brought the IMF and its conditionalities to Thailand and encouraged policy-makers and financial elites to begin to speak with the discourse of prudence and parsimony and gave ... relating to changing gender relations When groups of women are drawn to a remote area to work together in a factory setting and perhaps dormitory accommodation, they can in some cases be empowered to ... Economic and Business 26, No 5E (2010) 37-46 of its working to seek to manage the spatial location of such industrial zones and to take action to ensure smooth provision of services and related...

Ngày tải lên: 22/03/2014, 13:20

10 449 1
Support to the identification of potential risks for the environment and human health arising from hydrocarbons operations involving hydraulic fracturing in Europe doc

Support to the identification of potential risks for the environment and human health arising from hydrocarbons operations involving hydraulic fracturing in Europe doc

... Measures and approaches to reduce land disturbance and land-take • Measures to address releases to air and to effectively reduce noise during drilling, fracturing and completion • Measures to address ... m3/day • Years to 4: 32,000 to 100,000 m3/day declining to 14,000 to 35,000 m3/day • Years to 10: 14,000 to 35,000 m3/day declining to 8,000 to 16,000 m3/day • Years 11 and after: 8,000 to 16,000 ... risks/impacts, resources and energy consumed in order to manufacture sand and other proppants, gravel, stone and chemical additives for well pad construction; or to construct and maintain road and pipeline...

Ngày tải lên: 23/03/2014, 00:20

292 586 0
w