... re-innervating the joint In this study we investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating in the facet joint MATERIALS AND METHODS Patient ... with a median period of pain relief being months The range of relief for the radiofrequency group was from zero days to 16 months for all 26 patients who underwent the radiofrequency procedure Of ... patients reported significant pain improvement for at least 36 months postoperatively This durable effect is particularly promising, given the propensity for facet joint pain to return following dorsal...
Ngày tải lên: 26/10/2012, 09:32
... laminoforaminotomy for unilateral radiculopathy: results of a new technique in 100 cases J Neurosurg 2001; 95: 51-57 Khoo LT, Fessler RG Microendoscopic decompressive laminotomy for the treatment ... invasive, such as endoscopic laminoforaminoplasty, should decrease the risk of major adverse events, allow for same day hospital discharge, and decrease the need for postoperative analgesia and ... conflict of interest exists References Kunogi J, Hasue M Diagnosis and operative treatment of intraforaminal and extraforaminal nerve root compression Spine 1991; 16: 1312-1320 Porter RW, Hibbert...
Ngày tải lên: 26/10/2012, 09:57
High-intensity Low-pressure Electrodeless Mercury-Argon Lamp for UV Disinfection of Wastewater
... mechanism for protective quartz sleeves (See fig 3) Structurally, each current path is composed of UV lamps, a submerged weir and an overflow weir to pass the sewage around the lamps uniformly Therefore, ... disaffection system for wastewater treatment is shown in Fig The disinfection system is a standard product incorporating a set of electrodeless UV lamps By combining and installing several UV modules, ... suitable for any size sewage treatment plant without increasing a water head loss in a water channel The rated water amount of treatment of a lamp module is 60 (m3/hour) Under the conditions of UV...
Ngày tải lên: 05/09/2013, 09:08
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH analysis and was stored at -80oC The extraction of DNA was performed with Fast ... was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ( Dionishi et al., 2002) were employed for the detection ... (2001) Different conditions for the implementation of QP-PCR was applied, and the condition was optimized In general, the higher concentration of primers can lead to the formation of primer dimers...
Ngày tải lên: 05/09/2013, 09:38
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater
... increased with the decreasing temperature either for dried sludge (Zhou, 1992; Zhou and Banks, 1993) or for activated carbon (McCreary and Snoeyink, 1980) Therefore, it is hypothesized that there existed ... L (1999) Biological wastewater treatment: Second edition, Marcel Dekker, Inc Huang J C and Li L (2000) An innovative approach to maximize primary treatment performance Water Sci and Tech., 42(12), ... taken from the incubation reactors and were then centrifuged and washed using tap water for three times Before the adsorption tests, the sludge was diluted to the required MLSS level with the same...
Ngày tải lên: 05/09/2013, 09:38
Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx
... reserved This material may be freely reproduced for educational and not -for- profit purposes No reproduction by or for commercial organisations, or for commercial purposes, is allowed without the ... not recommended for the first-line treatment of metastatic colorectal cancer 1.2 Cetuximab in combination with irinotecan is not recommended for the secondline or subsequent treatment of metastatic ... bevacizumab treatment: gastrointestinal perforation, wound-healing problems, hypertension, proteinuria, arterial thromboembolism, haemorrhage and cardiomyopathy For full details of side effects and contraindications, ...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Risk Factors in Implant Denistry: Simplified Clinical Analysis for Predictable Treatment ppt
... Regular Platform implants, a mesiodistal distance of mm, center to center, is necessary for avoiding interference between implants or implant and teeth For Narrow Platform, mm is required, and for Wide ... oral hygiene is not relevant for the implant treatment per se However, attention should be paid to patients who have been edentulous for a long time They have often forgotten the simple measures ... is an indicator of the potential risk for complications of implant treatment Availability Certain treatment requires frequent availability of the patient For example, after a guided bone regeneration...
Ngày tải lên: 16/02/2014, 15:20
Hydroxyurea for the Treatment of Sickle Cell Disease docx
... specifically addressed barriers to the use of this drug for sickle cell disease Therefore, we sought information on barriers to the use of other therapies for treatment of sickle cell disease, including ... clinical studies) of hydroxyurea treatment for patients who have sickle cell disease? What is the effectiveness (in everyday practice) of hydroxyurea treatment for patients who have sickle cell ... with solid tumors It was first approved by the FDA in 1967 for the treatment of neoplastic diseases and is presently approved for the treatment of melanoma, resistant chronic myelocytic leukemia...
Ngày tải lên: 05/03/2014, 10:20
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... a pertinent study performed in vivo, Lee et al [40] crossed AD Tg mice (Tg2576) with mice deficient in ZnT3, the protein responsible for loading Zn into synaptic vesicles for release into the ... synaptically released Zn is required for the formation of amyloid plaques in Tg mice [41] Although amyloid plaques contain predominantly higher order Ab aggregates, an initial formation of toxic Ab oligomers ... of matrix metalloproteinases (MMPs) The capacity for MMPs to degrade Ab has been reported by several groups [61–64] Treatment with CQ may therefore have a two-fold effect on Ab; by binding extracellular...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt
... preclinical testing include an antiglycoprotein NMB (scFv) for the treatment of malignant gliomas and melanomas [30], an anti-HIV-1 gp120 (scFv) for the treatment of HIV [31,32] and a RIT targeted to osteosarcomas ... require activation for catalytic activity still need a cleavable furin site for full activity (J E Weldon, unpublished results) Separation of the catalytic and binding domains may therefore serve an ... ERAD system for transport across the ER membrane to the cytosol [91,92] To date, we are unaware of direct evidence for transport of PE through the Sec61p translocon Additional support for the hypothesis...
Ngày tải lên: 22/03/2014, 15:21
A Review of Qigong Therapy for Cancer Treatment pptx
... one plate for each treatment condition: EQT treatment, sham treatment, incubator control, room temp control The Chinese Qigong healer emitted Qi directly to the cell culture plates for 10 minutes ... activity is 17.4 ± 7.1% for EQ only; 20.1 ± 5.7% for CY plus EQ, versus 8.4 " 3.7% for control (p < 01); the MTC activity for CY+EQ is 11.0 ±5.6%, versus 23.1 ± 7.3% for the control (p < 01) ... Qigong group practiced Guo-Lin Qigong for months before the follow-up measurements were taken Table presents the results of UDS rates before and after the treatment The Qigong group had significant...
Ngày tải lên: 22/03/2014, 17:20
Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc
... therapies, when considering all treatment protocols, for the treatment for SUI in women, in the short and medium terms (up to 12 months after treatment) ? What is the evidence for different types of PFMT? ... considering all treatment protocols, for the treatment for SUI in women, in the short and medium terms (up to 12 months after treatment) ? 1.1 PFMT alone Twelve 12 RCTs with 13 treatment arms, ... evidence for the optimal period of treatment and number of treatments? Duration of treatment period Parkkinen (2004) reported a mean of (3–29) weekly treatments with subjects ceasing treatment...
Ngày tải lên: 28/03/2014, 14:20
Best Practice Policy Statement on Cryosurgery for the Treatment of Localized Prostate Cancer pptx
... the optimal treatment for this disease In the American Urological Association’s (AUA) 2007 Guideline for the Management of Clinically Localized Prostate Cancer: 2007 Update, multiple treatment ... cryosurgery for the treatment of localized prostate cancer A BPS uses published data in concert with expert opinion, but does not employ formal metaanalysis of the literature A Medline search was performed ... overnight stay, it is an option for patients seeking shorterduration treatment of clinically organ-confined prostate cancer For patients who desire minimally invasive therapy for their intermediate disease,...
Ngày tải lên: 28/03/2014, 23:20
SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE
... 13 1.2 Treatments of air pollution 1.2.1 Separated treatment of pollutants 1.2.1.1 CO treatments 1.2.1.2 VOCs treatments 1.2.1.3 NOx treatments 1.2.1.4 Soot treatment 1.2.2 Simultaneous treatments ... methods for exhaust gas treatment They were devided into two categories: treatments of single pollutant and simultaneous treatment of pollutants 1.2.1 Separated treatment of pollutants 1.2.1.1 CO treatments ... in the design strategy for vehicle operation [43] 1.3 Catalyts for the exhaust gas treatment TWC is one of the best solutions for treatment of exhaust gas It can transform polluted agents approximately...
Ngày tải lên: 12/05/2014, 17:14
báo cáo hóa học:" Identifying alemtuzumab as an anti-myeloid cell antiangiogenic therapy for the treatment of ovarian cancer" pdf
... the described work Authors' contributions HP: Performed experiments, wrote manuscript, GS: Performed experiments, IS: Performed experiments, KM: Performed experiments, AK: Contributed research material, ... = per group) daily for 48 hours and then ascites cells were harvested, red cells were lysed using ACK buffer, and whole ascites cell samples were analyzed for VLC by FACS Treatment of Flank Tumors ... Cambridge, MA) for thirty minutes Isolated VLC were washed and incubated with 10% human serum or heat inactivated serum at 37°C for one hour (human serum was inactivated by incubating at 60°C for thirty...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Hypoglycemic and beta cell protective effects of andrographolide analogue for diabetes treatment" pot
... pharmacologically For these reasons, LA is one of the most widely used health supplements and has been licensed and used for the treatment of symptomatic diabetic neuropathy in Germany for more than ... pretreated with Andro, LA and AL-1 at a concentration of μM for h and exposed to 450 mg/dl glucose or μM glibenclamide for another h After treatment, mM luminol (in DMSO) was added to the cells (final ... diabetic + vehicle control; c, i, diabetic + AL-1 20 mg treatment; d, j, diabetic +AL-1 80 mg treatment; e, k, diabetic + Andro 50 mg treatment; f, l, diabetic + glibenclamide 1.2 mg treatemnt...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Recent progress towards development of effective systemic chemotherapy for the treatment of malignant brain tumors" docx
... conventional surgery and/or whole brain radiotherapy for the treatment of one or more brain metastases: A systematic review and meta-analysis Cancer Treatment Reviews 2006, 32:203 Lutterbach J, Bartelt ... RO, Leyvraz S: Promising survival for patients with newly diagnosed glioblastoma multiforme treated with concomitant radiation plus temozolomide followed by adjuvant temozolomide Journal of Clinical ... patients with glioblastoma multiforme at first relapse Annals of Oncology 2001, 12:259 Randomized Trial of Procarbazine, Lomustine, and Vincristine in the Adjuvant Treatment of High-Grade Astrocytoma:...
Ngày tải lên: 18/06/2014, 15:20
báo cáo sinh học:" How labour intensive is a doctor-based delivery model for antiretroviral treatment (ART)? Evidence from an observational study in Siem Reap, Cambodia" potx
... would cover 80% of the needs for ART for the province To reach such coverage for a chronic disease for which demand for care is high may be realistic Estimations for annual survival of ART patients ... doctors needed for treatment and follow-up of 1158 PLWHAs in September 2004 However, we documented important reductions in doctor-time per Table 1: Medical doctor time for antiretroviral treatment ... doctor-time for antiretroviral treatment (ART) for patients with initial CD4 < 200, September 2004 and August 2005, Chronic Diseases Clinic Siem Reap, Cambodia Page of (page number not for citation...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" What impact do Global Health Initiatives have on human resources for antiretroviral treatment roll-out? A qualitative policy analysis of implementation processes in Zambia" pptx
... information [18] Despite the limitations in detailed information, broad information on funding was obtained Interviews with key stakeholders confirmed that the preponderance of funding for treatment ... and forms of this support concerning human resources, specifically support provided for treatment roll-out, are explored later Page of (page number not for citation purposes) Human Resources for ... funding for human resources This suggests that support by GHIs, particularly PEPFAR implementers, is provided in the form of training and financial support for materials and meetings, for many...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" A systematic review of task- shifting for HIV treatment and care in Africa" potx
... Resources for Health 2009, 7:49 doi: 10.1186/1478-4491-8-8 Cite this article as: Callaghan et al., A systematic review of task- shifting for HIV treatment and care in Africa Human Resources for Health ... the process should be formalized and rationalized for the long term This includes ensuring staff competencies and adequate working conditions [24] This perspective takes for granted the unavoidable ... primary health care model for HIV care of patients with active tuberculosis: antiretroviral treatment initiation decision-making 5th IAS Conference on HIV Pathogenesis, Treatment and Prevention,...
Ngày tải lên: 18/06/2014, 17:20