content is critical for webinar effectiveness

... may be one of the mechanisms responsible for drug-induced apoptosis in a variety of JNK activation is critical for AG1478-induced apoptosis cancer cells of different histotype [51] Chang et al ... and analyzed for phospho-JNK content (upper), as well as for JNK content (lower) (C) The cell lysates were analyzed for phospho-p38 content (upper panel), as well as for p38 (lower) Similar results ... activation is critical for AG1478-induced apoptosis A B a Fig Induction of apoptosis by AG1478 (A) PC-9 cells were seeded into a 96-well microplate, and treated with AG1478 at various concentrations for...

Ngày tải lên: 18/02/2014, 13:20

... al F13 critical for interaction among the CP subunits monomeric form of the protein [10] This protein failed to assemble, form disks or interact with RNA in vitro [10] On the basis of this result, ... disks Results for PapMV disks and CP6–215 disks differed from those for F13L and F13Y disks, and suggest that there is still some RNA associated with recombinant F13L and F13Y disks This could partially ... three forms were as follows: NLP, 33%; disks, 36%; and monomers, 31% This current profile differs slightly from the first one that we published [9] This is probably because the methods used for bacterial...

Ngày tải lên: 07/03/2014, 05:20

... conserved biochemical mechanism among monothiol Grxs The Grx3 null mice demonstrate that this protein is essential for embryogenesis Specifically, mammalian Grx3 is required for efficient cell cycle ... expression is in tissues and embryos and induced by oxidative stress (A) Ten micrograms of total RNA isolated from brain, heart, spleen, liver, kidney, stomach, muscle, testis, lung and fat tissues ... B C D E F a b c d e f Fig Grx3 is critical for cell-cycle progression at G2 ⁄ M phase (A) Western blot analysis of Grx3 expression in Grx3-KD HeLa cells in comparison with control cells (B) Quantification...

Ngày tải lên: 14/03/2014, 23:20

... first 95 codons of the amyQ gene from pKTHM102 [54] This paper Invitrogen This paper This paper This paper This paper [18] This paper This paper This paper trpC2 like 168; amyE::X; Cmr Originally ... subtilis is not responsible for the lack of export of AmyQ containing the Ala signal peptide In conclusion, our present observations imply that signal peptide hydrophobicity is critical for early ... primer for construction of truncated AmyQ variants for synthesis of nascent chains amyQ95 GCCGGATCCTTCTCCTAAATCATACAA Amplification primer for construction of truncated AmyQ variants for synthesis...

Ngày tải lên: 16/03/2014, 22:20

... this paper For W59A and W59L, the forward primer was designed based on W58 mutation except for the position change (5¢-CCTTTCAGACCTTGGXXXGA AAGATAC-3¢, where XXX ¼ GCG, CTG, respectively, for ... Parameters for the hydrolysis of starch and oligosaccharides All assays were performed at pH 7.1 Average kinetic errors in kinetic parameters: specific activity (± 2–5%) for HSAmy and 15–20% for the ... the specific activities for starch hydrolysis (Table 2) For the mutants W58A, W58L or W58Y, the specific activity is 150–180-fold lower compared with the wild-type enzyme For smaller oligosaccharides...

Ngày tải lên: 23/03/2014, 12:20

... experiments induced apoptosis These ®ndings clearly demonstrate that DAP kinase activity is critical for C2- and C8-ceramideinduced apoptosis in PC12 cells DISCUSSION DAP kinase is a Ca2+/calmodulin-regulated ... apoptosis and necrosis However, it is not known whether the kinase activity is involved in apoptosis In the present study, we employed PC12 cells, extensively used as a model to study mechanisms ... activity of DAP kinase is critical for apoptosis The mechanism of DAP kinase activation has not been clear DAP kinase undergoes phosphorylation and the intrinsic activity is stimulated by Ca2+/calmodulin...

Ngày tải lên: 24/03/2014, 00:21

... zebrafish The investigation also establishes zebrafish as a good study platform for protein arginine methylation Isolation of zebrafish histones and assay for histone methylation Experimental procedures ... (I) were analyzed by WISH A dorsal view of the 12 hpf is shown in (F) WISH with sense riboprobe is shown in (J) Immunofluorescent analysis with antiPRMT1 of 24-hpf embryos is shown in (K) a, adaxial ... methyltransferase Dnmt1 and histone lysine methyltransferase Suv39h1 (specific for H3K9), have been reported in zebrafish development [32] Methylation of histone H4 R3 is responsible for active chromatin...

Ngày tải lên: 28/03/2014, 23:20

... therefore discarded Mass spectrometry conrmed the two forms were distiguished by Cys95AMY1 glutathionylation in the lower pI form [38,5052] The aromatic replacements Met53Trp/Tyr had no visible ... PerkinElmer) and the plasmid was used for P pastoris transformation by electroporation [50] upon linearization at the BstXI site Screening was performed for Zeocin transformants on YPDS plates (1% yeast ... grateful to C Vincentsen for expert technical assistance, L H Sứrensen and the late B Corneliussen for amino acid analysis, and M.-B Rask and the late J Sage for DNA sequencing This work was supported...

Ngày tải lên: 31/03/2014, 08:20

... avian myeloblastosis virusreverse transcriptase at 42°C for 75 and 95°C for PCR conditions were set as follows: cDNA was amplified for X cycles (Table 1) of denaturation at 94°C for 30 sec, primer ... and LH for h; FSH(+): COCs were cultured with FSH and LH for h; EGF(-): COCs were cultured without EGF for h; EGF(+): COCs were cultured with EGF for h; +H89: COCs were cultured with H89 for h; ... essential for female fertility Science 2009, 324:938-941 Lochner A, Marais E, Genade S, Huisamen B, du Toit EF, Moolman JA: Protection of the ischaemic heart: investigations into the phenomenon of ischaemic...

Ngày tải lên: 20/06/2014, 07:20

... of lung edema; microvascular permeability; mRNA; ELISA analysis; and histopathological and immunohistochemical analysis by fixing in 4% paraformaldehyde at 25 to 30 cm H2O pressure and embedding ... is the threshold cycle number (the minimum number of cycles needed before the product can be detected)[40,41] The arithmetic formula for the ∆CT method is the difference in threshold cycles for ... Santa Cruz, CA) The tissue sections were washed with TRIS-buffered saline and then incubated for 60 with secondary biotinylated antibody The tissue sections were then washed in TRIS-buffered saline...

Ngày tải lên: 11/08/2014, 08:21

... this distinctive cell distribution, TLR4 signalling may therefore be triggered only upon exposure to a high amount of free or bacteria-associated LPS as occurs in occupational or infectious diseases ... these molecules would provide a mechanism for innate immune activation that is both independent and complementary to that produced by microbes alone This is likely to amplify the immune response ... Authors’ information FP has published in the fields of asthma, pulmonary hypertension and pulmonary inflammation His research is mainly focused on the role of immunological pathomechanisms in the...

Ngày tải lên: 12/08/2014, 14:20

... is conserved in each of the isoforms, but the LAP/ LAP* contain an N-terminal trans-activation domain, which is missing in the short LIP isoform (Figure 6A) The expression of these three isoforms ... synthesis Before the joining of the 60S ribosomal subunit, eIF2-GTP is hydrolyzed to eIF2-GDP and Pi is released, completing the step of translation initiation The hydrolysis of eIF2-GTP is accelerated ... amino acid synthesis, angiogenesis and intermediary metabolism The ATF4 gene is located on chromosome 22 at the locus 22q13 The ATF4 protein is 351 amino acid residues in length, consisting of three...

Ngày tải lên: 24/08/2014, 11:02

... to provide information for background and discussion related to this issue We searched the literature for reports Body mass index (BMI) is used to define overweight and obesity BMI is calculated ... -2.0 for rice, -1.2 for wheat flour, -1.3 for pork and -1.6 for edible oils The own-price elasticities for the amount of foods consumed were: -0.12 for rice, -0.16 for wheat flour, -0.38 for pork ... to pork for consuming foods were: 0.21 for wheat flour, 0.36 for coarse grains and 0.33 for edible oils; however, they were: -0.93 for rice and -0.32 for eggs What is known about the effectiveness...

Ngày tải lên: 17/03/2014, 08:20

... in critically ill patients: encouraging results from a small randomised controlled trial Crit Care 2008, 12: R52 Cooper AB, Thornley KS, Young GB, Slutsky AS, Stewart TE, Hanly PJ: Sleep in critically ... Sleep in the critically ill patient Sleep 2006, 29:707-716 Parthasarathy S, Tobin MJ: Sleep in the intensive care unit Intensive Care Med 2004, 30:197-206 Page of (page number not for citation ... surgical intensive care unit: are our patients sleeping? J Trauma 2007, 63:1210-1214 Aurell J, Elmqvist D: Sleep in the surgical intensive care unit: continuous polygraphic recording of sleep in nine...

Ngày tải lên: 13/08/2014, 10:20

... 5: Reasons for discordance between the effectiveness algorithm and the effectiveness gold standard Satisfied Effectiveness Did Not Satisfy Algorithm, Effectiveness Algorithm, Met Effectiveness ... perfect, performance of our effectiveness algorithm applied to administrative claims data By way of comparison, the corresponding performance characteristics in administrative data for a number ... was satisfied with the level of disease activity even though the patient did not meet the DAS28 criteria for low disease activity or improvement For the 23 treatment episodes where the effectiveness...

Ngày tải lên: 25/10/2012, 10:45

... syntax, lexis, discourse, semantics, and analysis of the discourse - ESP is in contrast with “General English” 10 In order to make the above mentioned absolute characteristics of ESP distinctive, ... activity is to one more time confirm the students’ understanding of the content • Ask for help Of course, at this stage it is indispensable for the teachers’ availability with the students’ asking for ... information technology in their learning but the teachers find it time and effort consuming From this result, it is time for the teachers to take advantages of visual aids in teaching reading for...

Ngày tải lên: 07/11/2012, 14:50

Ngày tải lên: 17/04/2013, 16:09

... syntax, lexis, discourse, semantics, and analysis of the discourse - ESP is in contrast with “General English” 10 In order to make the above mentioned absolute characteristics of ESP distinctive, ... attention to what he/she is reading to comprehend it to the fullest in content areas Regardless of reading for relaxation or reading for information in content areas, it is necessary to make sense ... suitable for a given purpose (Nuttall, 2000: 49) From this notion, scanning is a type of reading that involves finding a particular piece of information located in material that is otherwise of...

Ngày tải lên: 07/09/2013, 13:45

... Wiley & Sons, Inc For many people, 13 is an unlucky number Yet, today, 13 is the best number Why? Because 13 is the highest point value for any word In this game, you will list words and score ... his sister are in the same classroom adjacent to the one Amy is in (3) Frank’s sister is on the student council with Mary (4) Amy is a good athlete who plays three sports (5) Mary’s brother is ... problems for you to solve Work out your answers on a separate piece of paper and write your answers under each problem Think well! Christine is a teacher, Alexis is a doctor, and Ellen is a stockbroker...

Ngày tải lên: 25/10/2013, 16:20

... focus for your cepts Brain Writing An altern ative meth od to brain stormin g th at tries to en courag e un iform participation with in a g roup is brain writin g Like brain stormin g , it is desig ... out sh eets with space for a topic or keyword at th e top of th e pag e an d space wh ere ideas can be written It can be a differen t topic for each person or th e same for everyon e Write ideas ... treak/2009/11/brain-writing.html Con tin ue th e exercise for an an oth er ute In some cases, tradition al brain stormin g meth ods may best suit your team en viron men t an d g oals For th ose wh o prefer virtual...

Ngày tải lên: 09/02/2014, 20:33