... teaching a graduate course at night was a little overwhelming at times I am lucky to have an "infrastructure" of family and friends to help take care of me Thank you to my mom, grandparents, Jane, James, ... tri-state area 7 SOCIAL RESPONSIBILITY Our family has always felt that giving back to the community is an important and admirable goal Each year we hold a Christmas party for the less fortunate ... its tradition, culture, and approach to business you want to uphold and pass on to others? List three ways you can translate what you stand for as a leader into words and actions For instance,...
Ngày tải lên: 27/02/2014, 20:49
... really matter what the passport is because Mary is going to have some people come up and ask her about a passport after the gathering Curiosity is part of human nature, we're all curious and want ... had Michael speaks clearly, gears his presentation to the audience and does so with humor Almost all of the attendees came up to me after Michael's presentation and said he was the best speaker ... on a Cloud” mattress Once you try a Sleep on a Cloud mattress, you'll never want to sleep on another mattress again Now see me after our gathering because I have just passports to give away to...
Ngày tải lên: 08/03/2014, 15:20
HOW TO BECOME A BETTER NEGOTIATOR potx
... personal antagonisms, and organizational turf warfare Unmanaged conflict is often costly It can divert energy, time, and resources from legitimate and important personal and organizational goals and ... negotiating mistakes that people make and how you can avoid them That chapter ends with timely guidance on how to negotiate across national and cultural boarders Negotiation is a uniquely human and ... negotiator’s disposal is one or more practical alternatives to the deal currently on the table Alternatives make it possible for a negotiator to say, ‘‘If this negotiation ’’ Consider fails to produce...
Ngày tải lên: 30/03/2014, 11:21
Branding Yourself OnlineHow to Use the Internet to Become a Celebrity or Expert in Your Fieldby pptx
... program All Things Considered has listeners; Howard Stern has fans Entertainment Tonight has viewers; David Letterman has fans The Dallas Cowboy Cheerleaders have admirers; Pamela Anderson has ... fan pie that they command is more than enough to allow them to make a living playing their brand of music Contrary to typical corporate strategy, as an individual, you don’t have to win over a ... trying to appeal to too broad a range of potential fans Don’t get caught in this trap To create an indelible brand name for yourself, you must stand for something specific and not be a generalist...
Ngày tải lên: 28/06/2014, 12:20
Branding Yourself OnlineHow to Use the Internet to Become a Celebrity or Expert docx
... program All Things Considered has listeners; Howard Stern has fans Entertainment Tonight has viewers; David Letterman has fans The Dallas Cowboy Cheerleaders have admirers; Pamela Anderson has ... fan pie that they command is more than enough to allow them to make a living playing their brand of music Contrary to typical corporate strategy, as an individual, you don’t have to win over a ... trying to appeal to too broad a range of potential fans Don’t get caught in this trap To create an indelible brand name for yourself, you must stand for something specific and not be a generalist...
Ngày tải lên: 28/06/2014, 18:20
How to Become a Master of Life pptx
... wrong as a book on juggling which claims that the balls 'naturally' want to be in a neat arc and that your task as a juggler is to 'get in touch' with this natural state and 'release' the balls to ... sweating and striving to maintain the arc, but calm, certain, almost in a meditative state Happiness Is Not Natural Is contentment the 'natural' human state? Well, that depends on what you mean ... move towards a state of permanent intense happiness (joy), any more than the juggler aims to attain a perfect frozen arc of equally-spaced balls above her head so that she might relax, arms folded...
Ngày tải lên: 06/07/2014, 02:20
How to become a hacker
... behave as though you have this kind of attitude yourself And to behave as though you have the attitude, you have to really believe the attitude" Tác giả muốn nói rằng, bạn thật không ch a trang ... khác Paul Graham viết tiểu luận có tênhttp://www.paulgraham.com/gh.html khác làhttp://www.paulgraham.com/college.html ông ta nói đến điều nên làm Peter Seebach trì tranghttp://www.plethora.net/~seebs/faqs/hacker.html ... us apart [Up] [Print Copy] [Bài viết] Bài dịch: How To Become A Hacker - 15/09/2006 07:07:54 (+0700) | #2 | 23453 [Avatar] conmale Administrator Joined: 07/05/2004 23:43:15 Bài gởi: 9275 Đến từ:...
Ngày tải lên: 05/07/2015, 11:23
Ways to become a better presenter
... of a constructively-critical friend can be useful 4 Keep it short I like Guy Kawasaki’s advice: I like Guy Kawasaki’s advice: stick to the 10:20:30 Rule I like Guy Kawasaki’s advice: stick to ... the tools Well, Don’t the tools blame the workman It’s worth doing it well These tips and resources should help turn you into a presentation Study the Best is a great place to watch people at ... ever read text off a slide Ask questions For small groups For small groups stop regularly For small groups stop regularly every few minutes 8 Tell a story Show what the problem is Show what the...
Ngày tải lên: 10/03/2016, 11:43
Cambridge.University.Press.Learning.Medicine.How.to.Become.and.Remain.a.Good.Doctor.Jan.2008.pdf
... at a substantial financial disadvantage if they have already had a student loan for higher education Even if eligible for bursaries or additional loans, those who have already achieved financial ... degree which acts as the basis for a provisional licence to practise as a doctor, are largely a matter of hard slog, particularly in the later years They used to be taken as a big bang at the end ... qualifications from England, Wales and Northern Ireland BMAT compulsory Graduate entry and Pre-Medical course available UKCAT compulsory Graduate entry available Graduate entry available UKCAT compulsory...
Ngày tải lên: 21/09/2012, 10:58
In order to become competent in a foreign language
... different speakers and are related to each other in such a way they form a pair type They call them an adjacency pair The adjacency pair always consists of a first part and a second part The utterance ... conversation analysis and discourse analysis 5 1.2.1 Conversation analysis Many conversational analysis researchers have defined ordinary conversation as the kind of casual, social talk that routinely ... some factors affecting to this calculation: speakers estimates of the social distance assumed to separate speaker and hearer, the relative social power of speaker and hearer, and the extent to which...
Ngày tải lên: 09/04/2013, 08:49
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... nước trong”, “Gạo Cần Đước, nước Đồng Nai”, “Cơm Nai, R a; cá Rí, Rang” hay: “Ai miệt Tháp Mười, Cá tôm sẵn bắt, l a trời sẵn ăn ” (ca dao) v.v Trong Gia Đònh thành thông chí (GĐTTC) có đoạn:...
Ngày tải lên: 17/04/2013, 16:09
Tài liệu CARBON ALLOYSNOVEL CONCEPTS TO DEVELOP CARBON SCIENCE A N D TECHNOLOGYE. YASUDA, M. INAGAKI 10/2007 ppt
... Yamabe (Kyoto Univ.), Osamu Yamamoto (Kanuguwa Znst of Tech.), Takakazu Yamamoto (Tokyo Inst of Tech.), Hiromi Yamashita (Osaka Pref Univ.),Toyohiko Yano (Tokyo Znst of Tech.), Eiichi Yasuda (TokyoZnst ... of usage and are called classic carbon materials, in contrast to newly developed carbon materials the so-called new carbons Carbon materials play a part in our daily lives in various ways, many ... inner carbon atom, the total energy calculated for the fluorine atom attached to the edge carbon atom is 0.92 eV smaller than for an inner carbon atom When we compare the contribution to the total...
Ngày tải lên: 13/02/2014, 11:20
Tài liệu BIOINSPIRED CHEMISTRY FOR ENERGY A WORKSHOP SUMMARY TO THE CHEMICAL SCIENCES ROUNDTABLE pptx
... now and maintain close to a 30 percent growth rate for the next 20 years to have an impact Because coal with carbon capture and storage will take years to get on ground, it may be too late to make ... Postdoctoral Associate Tina M Masciangioli, Responsible Staff Officer Kela L Masters, Senior Program Assistant Ericka M McGowan, Associate Program Officer Sybil A Paige, Administrative Associate Sandi ... Research, Arlington, Virginia Apurba Bhattacharya, Texas A& M, Kingsville, Texas Louis Brus, Columbia, New York Leonard J Buckley,* Naval Research Laboratory, Washington, District of Columbia Mark...
Ngày tải lên: 19/02/2014, 09:20
Art to Help You Meditate on Death and Become a Better Man
... reminder that we’ll all have to pay the fiddler once our mortal hoedown is through Vanitas Vanitatum Omnia Vanitas Another sub-genre of memento mori art is called vanitas This artistic motif was particularly ... art is Danse Macabre, or Dance of Death This genre of art has its origins in late medieval times but became popular during the Renaissance Dance of Death paintings typically portray a skeleton (signifying ... and impermanent nature of our mortal life is cited as the inspiration for this morbid art Vanity of vanities, saith the Preacher, vanity of vanities; all is vanity What profit hath a man of all...
Ngày tải lên: 14/03/2014, 09:33
35 Simple Tools to Help You Become a Better Speaker pot
... buy into your message When you take a step forward towards your audience, it creates intimacy so step forward when you have an important point to make Taking a step backwards creates a negative ... Speaking Tips to Make You a Better Speaker by AKASH KARIA, Bestselling Author of “How to Deliver a Great TED Talk” http://amzn .to/ 16bo6h0 © 2013 by Akash Karia All rights reserved 35 Simple Tools ... techniques: Start with a Personal Story Begin your presentation with a story Stories are captivating and interesting Start with Question to create a Knowledge Gap Ask your audience a question For example,...
Ngày tải lên: 03/04/2014, 15:20
how to create a great ecommerce content strategy
... personally — your content has to have a personality (probably yours) and it has to speak to people rather than simply about them Use words like “you” when speaking about a customer’s need, rather ... else and never expresses an individual opinion Having an opinion means you're a player in your industry and someone to respect Again, as a start for writing content, go back to what got you into ... SHARED Marketing content should be “sharable” — i.e., it is content people will want to share and is in a form that is easy to share — videos, blogs and how -to articles, for example Videos attract...
Ngày tải lên: 23/05/2014, 19:02
content marketing think like a publisher - how to use content to market online and in social media
... into a rhythm beats falling out of visibility altogether Create a detailed editorial calendar—An editorial calendar plugs directly into the frequency framework Just as your local newspaper has ... or broadcast media has heard this familiar mantra ad infinitum In media, content is the bait It’s what captures eyeballs, ears, attention, and engagement It’s part of a timehonored contract with ... entitled Mainframe—The Art of the Sale • Dove’s Pro Aging campaign was a runaway success • The Old Spice Guy rocketed actor Isaiah Mustafa to fame • Ikea produced a popular series around the...
Ngày tải lên: 29/05/2014, 23:45
A Brief History of Economics: Artful Approaches to the Dismal Science pptx
... society has changed A woman was either a virgin and a saint or a harlot on the way to hell, a place whose mean temperature had been carefully calibrated, though few seemed to know it, except it to ... has managed to accumulate a small amount of cash and decides to use his money to buy goods at the fair and resell or barter them some days later after the fair is over and they cannot be so easily ... to as an example of a competitive market system, but Americans know that this is a fuzzy characterization There are few ingredients of a customary economy in the United States today, but a large...
Ngày tải lên: 28/06/2014, 09:20
báo cáo khoa học: "Genetic variation of g-tocopherol methyltransferase gene contributes to elevated a-tocopherol content in soybean seeds" pdf
... AQGV-GITLS -PVQAKRAND -PVQAQRANA -PVQAQRANA -PVQAQRANS -PVQAKRAND SPVQAQRAQQ -PVQAERANA -PVQAERGNA -PKQAARANA -PVQANRAIA LAAAQSLAHK LAAAQGLDDK LAAAQGLADK LAAAQGLADK LAAAQSLSHK LADAQGLNGK LAAAQGLADK ... (5’ to 3’) GCACAATAAATTGGGCCTGA GCGAGTGTTGGGCTAAGTCT Reverse KSC138-23 TAAAGCCGCCTAGCCGATTG Forward TGCAGCAATAATCAATCAAATAGAA Reverse KSC138-22 TTCAATCAAATTTAGCACGTGTATT Forward CGGTCCAGATTTAATTCTTTCACTC ... CCACATACTCTATATCATTCACACGAG Forward TGATTAACAGGGACAGTCGG Reverse b-tubulin CGCCAATCATAGGAGATATTGCATATG Reverse 18S rRNA GAAGCAAGTTTCCAACAGGTCG Reverse g-TMT3 Forward ACGGTATCTGATCGTCTTCG Forward GAGAAGAGTATCCGGATAGG...
Ngày tải lên: 11/08/2014, 11:21