construction of an in vitro model of a living cellular system
Báo cáo y học: "CD47 associates with alpha 5 integrin and regulates responses of human articular chondrocytes to mechanical stimulation in an in vitro model" pdf
... 5'-CACAAGTGTATTCCTTTCACGTCTTACTACTC-3'; glyceraldehyde-3phosphate dehydrogenase (GAPDH), 5'-CCACCCATGGCAAATTCCATGGCA-3' and 5'-TCTAGACGGCAGGTCAGGTCCACC-3'; and aggrecan, 5'TGAGGAGGGCTGGAACAAGTACC-3' and 5'-GGAGGTGGTAATTGCAGGGAACA-3' ... function-blocking anti-CD47/IAP antibody B6H12 is an anti-CD47/IAP antibody that has partial agonist activity SE 5A5 is an anti-SIRPα antibody N = ap < 0.001; bnot significant IAP, integrin-associated ... No Orazizadeh et al Table Effect of anti-CD47/IAP, anti-TSP-1, and anti-SIRPα on mechanically induced changes in human articular chondrocyte membrane potential Membrane potential (-mV) (mean ±...
- 11
- 441
- 0
Báo cáo y học: "Gender differences and inflammation: an in vitro model of blood cells stimulation in prepubescent children" pptx
... conceived of the study, and participated in its design and coordination All authors read and approved the final manuscript Author Details 1Department of Pulmonology and Allergology, Université ... multiple inflammatory and antiinflammatory mediators [24,25] Recently a new model of LPS interaction has been proposed including a signalling complex of receptors, formed following LPS stimulation, ... significant way, which was demonstrated by a linear regression analysis between the two cytokine levels for all the data related to some stimulation conditions, and in each separated group Table...
- 7
- 377
- 0
Báo cáo y học: "Gender differences and inflammation: an in vitro model of blood cells stimulation in prepubescent children" pot
... conceived of the study, and participated in its design and coordination All authors read and approved the final manuscript Author Details 1Department of Pulmonology and Allergology, Université ... multiple inflammatory and antiinflammatory mediators [24,25] Recently a new model of LPS interaction has been proposed including a signalling complex of receptors, formed following LPS stimulation, ... significant way, which was demonstrated by a linear regression analysis between the two cytokine levels for all the data related to some stimulation conditions, and in each separated group Table...
- 7
- 336
- 0
Báo cáo y học: " Cysteinyl-leukotrienes in the regulation of β2-adrenoceptor function: an in vitro model of asthma" ppsx
... human bronchial rings Relaxant responses to salbutamol in carbachol-contracted human bronchial rings Values of 100 and on y-axis represent maximal force in response to 10-6M carbachol and minimal ... human bronchial rings Relaxant responses to salbutamol in five carbachol-contracted human bronchial rings Values of 100 and on y-axis represent maximal force in response to 10-6M carbachol and ... equation and parameters compared using the extra sum of square principle [27] Parameter errors are expressed as percentage coefficient of variation (%CV) and calculated by simultaneous analysis...
- 11
- 243
- 0
Báo cáo y học: "Propofol: neuroprotection in an in vitro model of traumatic brain injury" pot
... fluorescence imaging Microscopy and staining PI is a nucleic acid intercalating agent that is membrane-impermeable in vital cells with intact cell membranes In damaged cells gaps in the cell membrane allow ... the nature of the model it excludes mechanisms of injury that may influence brain damage in the in vivo situation such as the absence of any injury pathways related or due to brain swelling inside ... KE, Meaney DF, McIntosh TK: In vitro central nervous system models of mechanically induced trauma: a review J Neurotrauma 1998, 15:911-928 Lahtinen H, Autere AM, Paalasmaa P, Lauri SE, Kaila K:...
- 8
- 329
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
- 9
- 444
- 0
báo cáo hóa học: " A refined in vitro model to study inflammatory responses in organotypic membrane culture of postnatal rat hippocampal slices" potx
... all experiments and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements We thank Dr Ewen MacDonald for checking the language of the manuscript and ... no other manipulations were done in any of the images Statistical power analysis and estimation of optimal sample size To determine the minimum number of animals, yet appropriate sample sizes ... understanding of innate and adaptive immune interactions and responses Downstream, a well known family of transcription factors, the nuclear factor kappa B (NF-κB), is one of the key players in the...
- 15
- 345
- 0
báo cáo hóa học:" Development of an in vitro three dimensional loading-measurement system for long bone fixation under multiple loading conditions: a technical description" potx
... compliment application of ASIF devices along the distal aspect of the lateral and cranial (anterior) radius surfaces with at least a 0.5 cm distance from potting material, and to have sufficient ... random sequence of load modes: axial compression, torsion, and CrCa and LM bending (n = 12), and in addition CaCr and ML bending (n = 8) Instron's RSBasLab software was used to apply load at a ... supports to a maximum at the central load application point Panjabi et al [16] reported that cortical bone longitudinal modulus of elasticity increases with increase in strain rate by a factor of 1.5...
- 11
- 482
- 0
Báo cáo y học: "Early Effects of anti-inflammatory [1, 2, 4]triazolo[4, 3-a] [1, 8]naphthyridine derivatives on human stimulated PMN and endothelial cells: an in vitro study" doc
... 8-naphthyridine and 2, 3-dihydrothiopyrano[2, 3-b]pyridine:potential antihypertensive agents – part IX Eur J Med Chem 2000, 35:815-826 Leonard JT, Gangadhar R, Gnanasam SK, Ramachandran S, Saravanan M, ... derivatives have been reported to possess antibacterial [4], antymicobacterial [5], antitumoral [6], anti-inflammatory [7], antiplatelet [8], gastric antisecretary [9], antiallergic [10], local anaesthetic ... 186:141-163 Avanzi GC, Gallicchio M, Bottarel F, Gammaitoni L, Cavalloni G, Buonfiglio D, Bragardo M, Bellomo G, Albano E, Fantozzi R, Garbarino G, Varnum B, Aglietta M, Saglio G, Dianzani U, Dianzani...
- 11
- 453
- 0
Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"
... Castaneda AZ, Marinero ML, Lanao JM In vitro studies of amikacin-loaded human carrier erythrocytes Transl Res 2008; 152(2):59-66 25 Hamidi M, Zarei N, Zarrin AH, Mohammadi-Samani S Preparation and in ... 281 Oda S, Nagahama R, Nakano K, Matoba T, Kubo M, Sunagawa K, Tominaga R, Egashira K Nanoparticle-mediated endothelial cell-selective delivery of pitavastatin induces functional collateral arteries ... Percent of pravastatin and hemoglobin release from loaded erythrocytes in PBS and plasma Data were tested by one-way analysis of variance and represented as mean ± SD Three samples in each group...
- 9
- 829
- 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ ... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used...
- 10
- 696
- 0
Báo cáo sinh học: " Development of an in vitro cleavage assay system to examine vaccinia virus I7L cysteine proteinase activity" pptx
... A1 0L (P 4a) gene was amplified by polymerase chain reaction using oligonucleotides KH10 (5' CATGCCATGGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGCTCGAGTTATTCATCATCAAAAGAGACAGAGTC-3'), digested ... protease, and an ubiquitin-degrading enzyme in yeast, as well as the identity of a catalytic triad composed of histidine, cysteine, and aspartic acid, I7L has been classified as a cysteine proteinase ... the lack of essential co-factors or inappropriate assay conditions As an alternative approach, we sought to develop a cleavage assay using infected cell extracts as the source of I7L activity and...
- 8
- 481
- 0
báo cáo hóa học:" Airborne particulate matter PM2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approach" docx
... Statistical analysis Data are expressed as means ± standard deviation Paired t-tests were run to compare two groups, and ANOVA with Results Clinical Characteristics of Subjects The general and clinical ... presence of Fe and Cu content into spherical and soot aggregates of the fine fraction indicates a combination of natural and anthropogenic sources influenced by smelter and incineration emissions in ... Journal of Occupational Medicine and Toxicology 2009, 4:17 Background Air pollutants such as particulates and exhaust gases can reach considerable levels in areas of heavy traffic or in towns near...
- 11
- 511
- 0
báo cáo hóa học:" Fibrin and poly(lactic-co-glycolic acid) hybrid scaffold promotes early chondrogenesis of articular chondrocytes: an in vitro study" docx
... markers; collagen type II and aggrecan core protein was steadily expressed in fibrin/PLGA and PLGA Interestingly, suppression of collagen type I was observed in fibrin/PLGA and PLGA at weeks and ... Ruszymah BHI, Samsudin OC, Munirah S, Chen HC, Sharifah Salmah SH, Mohd Azam SGK, Aminuddin BS: Repair of articular cartilage after implantation with autologous engineered cartilage made using autologous ... of antibiotics and antimycotic (Gibco), 200 mM L-glutamine (Gibco) and 50 μg/ml of ascorbic acid (Sigma) All cultures were maintained in 5% CO2 incubator (Optima Model 560, Optima Inc, USA) at...
- 10
- 259
- 0
báo cáo hóa học:" The effect of newer anti-rheumatic drugs on osteogenic cell proliferation: an in-vitro study" doc
... Findlay DM, Zannettino AC: RANKL expression is related to the differentiation state of human osteoblasts J Bone Miner Res 2003, 18(6):1088-98 Tanaka E, Taniguchi A, Urano W, Yamanaka H, Kamatani ... is as sensitive as radioactive assay with a significantly lower inter- and intra-tester variability [22] The change in absorbance at 450 nm after 24 h was used for analysis http://www.josr-online.com/content/4/1/17 ... L-Glutamine – Gibco, Paisley, Scotland) to remove cells remaining in the intra-trabecular spaces and plated at fragment per well in a 24-well plate containing ml of control medium (α-MEM containing...
- 7
- 337
- 0
báo cáo hóa học:" Development of an in vitro cleavage assay system to examine vaccinia virus I7L cysteine proteinase activity" docx
... A1 0L (P 4a) gene was amplified by polymerase chain reaction using oligonucleotides KH10 (5' CATGCCATGGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGCTCGAGTTATTCATCATCAAAAGAGACAGAGTC-3'), digested ... protease, and an ubiquitin-degrading enzyme in yeast, as well as the identity of a catalytic triad composed of histidine, cysteine, and aspartic acid, I7L has been classified as a cysteine proteinase ... the lack of essential co-factors or inappropriate assay conditions As an alternative approach, we sought to develop a cleavage assay using infected cell extracts as the source of I7L activity and...
- 8
- 336
- 0
Báo cáo khoa học: "Contribution of the xenograft bone plate-screw system in lumbar transpedicular stabilization of dogs: an in-vitro study" docx
... than group I In TS, the usage of the MPS system has some disadvantage such as loosening, bending, breaking or pulling out of the screws and plates, and the maximum inter- segmental rigidity and ... evaluation of more than 200 cases South Med J 1963, 56, 1367-1377 Hasegawa K, Takahashi HE, Uchiyama S, Hirano T, Hara T, Washio T, Sugiura T, Youkaichiya M, Ikeda M An experimental study of a ... 194 Hakan Salci et al Fig (A) Xenograft bone plates and screws used for transpedicular stabilization (B) Metal plates and screws used for transpedicular stabilization Fig (A) View of a tensile-compression...
- 4
- 242
- 0
Báo cáo y học: "An in vitro study investigating the survival and phenotype of mesenchymal stem cells following injection into nucleus pulposus tissue" pot
... collagen and Alizarin red staining, and participated in interpretation of the data AJF participated in interpretation of the data and contributed to the preparation of the final manuscript JAH ... UK) and images were captured using a digital camera and Bioquant Nova image analysis system (BIOQUANT Image Analysis Corporation, Nashville TN, USA) Immunofluorescence images were viewed under a ... implantation in rat intervertebral discs Ann Biomed Eng 2004, 32:430-434 36 Hiyama A, Mochida J, Iwashina T, Omi H, Watanabe T, Serigano K, Tamura F, Sakai D: Transplantation of mesenchymal stem cells in...
- 10
- 434
- 0
Báo cáo y học: "In vitro model for the analysis of synovial fibroblast-mediated degradation of intact cartilage" pptx
... Germany) Proteoglycan loss from cartilage was quantified after staining with safranin-O and counterstaining with light green at low magnification (40×) using the image analysing software DatInfMeasure ... were calculated by the software using the standard curves In order to normalise the amount of cDNA in each sample and to guarantee the comparability of the calculated mRNA expression in all analysed ... study and participated in the layout, writing and finalisation of the manuscript Acknowledgements We thank Mrs Cordula Müller and Bianca Lanick for excellent technical assistance We are grateful...
- 20
- 524
- 0
Báo cáo y học: "Differential direct effects of cyclo-oxygenase-1/2 inhibition on proteoglycan turnover of human osteoarthritic cartilage: an in vitro study" pptx
... in the papain digest of cartilage samples, as a measure of proteoglycan content, was analyzed in the same way Blue staining was quantified photometrically by the change in absorbance at 620 nm ... in HT-29 colon adenocarcinoma cells J Clin Invest 1995, 96:491-503 47 Zhang X, Morham SG, Langenbach R, Young DA: Malignant transformation and antineoplastic actions of nonsteroidal antiinflammatory ... participated in its design and coordination, and helped to draft the manuscript SM and NJ carried out the experiments and performed all of the assays All authors read and approved the final manuscript...
- 9
- 557
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008