construction of an in vitro model of a living cellular system

... 5'-CACAAGTGTATTCCTTTCACGTCTTACTACTC-3'; glyceraldehyde-3phosphate dehydrogenase (GAPDH), 5'-CCACCCATGGCAAATTCCATGGCA-3' and 5'-TCTAGACGGCAGGTCAGGTCCACC-3'; and aggrecan, 5'TGAGGAGGGCTGGAACAAGTACC-3' and 5'-GGAGGTGGTAATTGCAGGGAACA-3' ... function-blocking anti-CD47/IAP antibody B6H12 is an anti-CD47/IAP antibody that has partial agonist activity SE 5A5 is an anti-SIRPα antibody N = ap < 0.001; bnot significant IAP, integrin-associated ... No Orazizadeh et al Table Effect of anti-CD47/IAP, anti-TSP-1, and anti-SIRPα on mechanically induced changes in human articular chondrocyte membrane potential Membrane potential (-mV) (mean ±...

Ngày tải lên: 09/08/2014, 10:22

... conceived of the study, and participated in its design and coordination All authors read and approved the final manuscript Author Details 1Department of Pulmonology and Allergology, Université ... multiple inflammatory and antiinflammatory mediators [24,25] Recently a new model of LPS interaction has been proposed including a signalling complex of receptors, formed following LPS stimulation, ... significant way, which was demonstrated by a linear regression analysis between the two cytokine levels for all the data related to some stimulation conditions, and in each separated group Table...

Ngày tải lên: 11/08/2014, 03:20

... conceived of the study, and participated in its design and coordination All authors read and approved the final manuscript Author Details 1Department of Pulmonology and Allergology, Université ... multiple inflammatory and antiinflammatory mediators [24,25] Recently a new model of LPS interaction has been proposed including a signalling complex of receptors, formed following LPS stimulation, ... significant way, which was demonstrated by a linear regression analysis between the two cytokine levels for all the data related to some stimulation conditions, and in each separated group Table...

Ngày tải lên: 11/08/2014, 06:22

... human bronchial rings Relaxant responses to salbutamol in carbachol-contracted human bronchial rings Values of 100 and on y-axis represent maximal force in response to 10-6M carbachol and minimal ... human bronchial rings Relaxant responses to salbutamol in five carbachol-contracted human bronchial rings Values of 100 and on y-axis represent maximal force in response to 10-6M carbachol and ... equation and parameters compared using the extra sum of square principle [27] Parameter errors are expressed as percentage coefficient of variation (%CV) and calculated by simultaneous analysis...

Ngày tải lên: 12/08/2014, 16:20

... fluorescence imaging Microscopy and staining PI is a nucleic acid intercalating agent that is membrane-impermeable in vital cells with intact cell membranes In damaged cells gaps in the cell membrane allow ... the nature of the model it excludes mechanisms of injury that may influence brain damage in the in vivo situation such as the absence of any injury pathways related or due to brain swelling inside ... KE, Meaney DF, McIntosh TK: In vitro central nervous system models of mechanically induced trauma: a review J Neurotrauma 1998, 15:911-928 Lahtinen H, Autere AM, Paalasmaa P, Lauri SE, Kaila K:...

Ngày tải lên: 13/08/2014, 16:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

Ngày tải lên: 16/03/2014, 01:20

... all experiments and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements We thank Dr Ewen MacDonald for checking the language of the manuscript and ... no other manipulations were done in any of the images Statistical power analysis and estimation of optimal sample size To determine the minimum number of animals, yet appropriate sample sizes ... understanding of innate and adaptive immune interactions and responses Downstream, a well known family of transcription factors, the nuclear factor kappa B (NF-κB), is one of the key players in the...

Ngày tải lên: 19/06/2014, 22:20

... compliment application of ASIF devices along the distal aspect of the lateral and cranial (anterior) radius surfaces with at least a 0.5 cm distance from potting material, and to have sufficient ... random sequence of load modes: axial compression, torsion, and CrCa and LM bending (n = 12), and in addition CaCr and ML bending (n = 8) Instron's RSBasLab software was used to apply load at a ... supports to a maximum at the central load application point Panjabi et al [16] reported that cortical bone longitudinal modulus of elasticity increases with increase in strain rate by a factor of 1.5...

Ngày tải lên: 20/06/2014, 01:20

... 8-naphthyridine and 2, 3-dihydrothiopyrano[2, 3-b]pyridine:potential antihypertensive agents – part IX Eur J Med Chem 2000, 35:815-826 Leonard JT, Gangadhar R, Gnanasam SK, Ramachandran S, Saravanan M, ... derivatives have been reported to possess antibacterial [4], antymicobacterial [5], antitumoral [6], anti-inflammatory [7], antiplatelet [8], gastric antisecretary [9], antiallergic [10], local anaesthetic ... 186:141-163 Avanzi GC, Gallicchio M, Bottarel F, Gammaitoni L, Cavalloni G, Buonfiglio D, Bragardo M, Bellomo G, Albano E, Fantozzi R, Garbarino G, Varnum B, Aglietta M, Saglio G, Dianzani U, Dianzani...

Ngày tải lên: 11/08/2014, 08:21

... Castaneda AZ, Marinero ML, Lanao JM In vitro studies of amikacin-loaded human carrier erythrocytes Transl Res 2008; 152(2):59-66 25 Hamidi M, Zarei N, Zarrin AH, Mohammadi-Samani S Preparation and in ... 281 Oda S, Nagahama R, Nakano K, Matoba T, Kubo M, Sunagawa K, Tominaga R, Egashira K Nanoparticle-mediated endothelial cell-selective delivery of pitavastatin induces functional collateral arteries ... Percent of pravastatin and hemoglobin release from loaded erythrocytes in PBS and plasma Data were tested by one-way analysis of variance and represented as mean ± SD Three samples in each group...

Ngày tải lên: 25/10/2012, 11:10

... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ ... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used...

Ngày tải lên: 30/03/2014, 13:20

... A1 0L (P 4a) gene was amplified by polymerase chain reaction using oligonucleotides KH10 (5' CATGCCATGGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGCTCGAGTTATTCATCATCAAAAGAGACAGAGTC-3'), digested ... protease, and an ubiquitin-degrading enzyme in yeast, as well as the identity of a catalytic triad composed of histidine, cysteine, and aspartic acid, I7L has been classified as a cysteine proteinase ... the lack of essential co-factors or inappropriate assay conditions As an alternative approach, we sought to develop a cleavage assay using infected cell extracts as the source of I7L activity and...

Ngày tải lên: 19/06/2014, 08:20

... Statistical analysis Data are expressed as means ± standard deviation Paired t-tests were run to compare two groups, and ANOVA with Results Clinical Characteristics of Subjects The general and clinical ... presence of Fe and Cu content into spherical and soot aggregates of the fine fraction indicates a combination of natural and anthropogenic sources influenced by smelter and incineration emissions in ... Journal of Occupational Medicine and Toxicology 2009, 4:17 Background Air pollutants such as particulates and exhaust gases can reach considerable levels in areas of heavy traffic or in towns near...

Ngày tải lên: 20/06/2014, 00:20

... markers; collagen type II and aggrecan core protein was steadily expressed in fibrin/PLGA and PLGA Interestingly, suppression of collagen type I was observed in fibrin/PLGA and PLGA at weeks and ... Ruszymah BHI, Samsudin OC, Munirah S, Chen HC, Sharifah Salmah SH, Mohd Azam SGK, Aminuddin BS: Repair of articular cartilage after implantation with autologous engineered cartilage made using autologous ... of antibiotics and antimycotic (Gibco), 200 mM L-glutamine (Gibco) and 50 μg/ml of ascorbic acid (Sigma) All cultures were maintained in 5% CO2 incubator (Optima Model 560, Optima Inc, USA) at...

Ngày tải lên: 20/06/2014, 01:20

... Findlay DM, Zannettino AC: RANKL expression is related to the differentiation state of human osteoblasts J Bone Miner Res 2003, 18(6):1088-98 Tanaka E, Taniguchi A, Urano W, Yamanaka H, Kamatani ... is as sensitive as radioactive assay with a significantly lower inter- and intra-tester variability [22] The change in absorbance at 450 nm after 24 h was used for analysis http://www.josr-online.com/content/4/1/17 ... L-Glutamine – Gibco, Paisley, Scotland) to remove cells remaining in the intra-trabecular spaces and plated at fragment per well in a 24-well plate containing ml of control medium (α-MEM containing...

Ngày tải lên: 20/06/2014, 01:20

... A1 0L (P 4a) gene was amplified by polymerase chain reaction using oligonucleotides KH10 (5' CATGCCATGGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGCTCGAGTTATTCATCATCAAAAGAGACAGAGTC-3'), digested ... protease, and an ubiquitin-degrading enzyme in yeast, as well as the identity of a catalytic triad composed of histidine, cysteine, and aspartic acid, I7L has been classified as a cysteine proteinase ... the lack of essential co-factors or inappropriate assay conditions As an alternative approach, we sought to develop a cleavage assay using infected cell extracts as the source of I7L activity and...

Ngày tải lên: 20/06/2014, 04:20

... than group I In TS, the usage of the MPS system has some disadvantage such as loosening, bending, breaking or pulling out of the screws and plates, and the maximum inter- segmental rigidity and ... evaluation of more than 200 cases South Med J 1963, 56, 1367-1377 Hasegawa K, Takahashi HE, Uchiyama S, Hirano T, Hara T, Washio T, Sugiura T, Youkaichiya M, Ikeda M An experimental study of a ... 194 Hakan Salci et al Fig (A) Xenograft bone plates and screws used for transpedicular stabilization (B) Metal plates and screws used for transpedicular stabilization Fig (A) View of a tensile-compression...

Ngày tải lên: 07/08/2014, 20:23

... collagen and Alizarin red staining, and participated in interpretation of the data AJF participated in interpretation of the data and contributed to the preparation of the final manuscript JAH ... UK) and images were captured using a digital camera and Bioquant Nova image analysis system (BIOQUANT Image Analysis Corporation, Nashville TN, USA) Immunofluorescence images were viewed under a ... implantation in rat intervertebral discs Ann Biomed Eng 2004, 32:430-434 36 Hiyama A, Mochida J, Iwashina T, Omi H, Watanabe T, Serigano K, Tamura F, Sakai D: Transplantation of mesenchymal stem cells in...

Ngày tải lên: 09/08/2014, 01:22

... Germany) Proteoglycan loss from cartilage was quantified after staining with safranin-O and counterstaining with light green at low magnification (40×) using the image analysing software DatInfMeasure ... were calculated by the software using the standard curves In order to normalise the amount of cDNA in each sample and to guarantee the comparability of the calculated mRNA expression in all analysed ... study and participated in the layout, writing and finalisation of the manuscript Acknowledgements We thank Mrs Cordula Müller and Bianca Lanick for excellent technical assistance We are grateful...

Ngày tải lên: 09/08/2014, 01:22

... in the papain digest of cartilage samples, as a measure of proteoglycan content, was analyzed in the same way Blue staining was quantified photometrically by the change in absorbance at 620 nm ... in HT-29 colon adenocarcinoma cells J Clin Invest 1995, 96:491-503 47 Zhang X, Morham SG, Langenbach R, Young DA: Malignant transformation and antineoplastic actions of nonsteroidal antiinflammatory ... participated in its design and coordination, and helped to draft the manuscript SM and NJ carried out the experiments and performed all of the assays All authors read and approved the final manuscript...

Ngày tải lên: 09/08/2014, 07:20