... branches in several different directions In a distribution network that branches in several directions, there are advantages in having patch cabinets, at least in certain locations Again, it’s incumbent ... from a 144count cable, 12 cabinets from a 288-count cable, or 24 cabinets from a 576-count cable Using smaller feeder cables may provide some advantages For instance, winching a 576-count cable ... than building rings For example, a km serving area with four main routes would require about 20 km of fiber cable A ring serving the same area would require more than 31 km of cable A full ring...
Ngày tải lên: 24/01/2014, 11:20
... Public Health Agency, Barcelona, Spain a Natalia Valero Muñoz Public Health Agency, Barcelona, Spain a Miguel Angel Espinosa Martinez Andalusian School of Public Health, Granada, Spain a Alejandro ... Romania Martin Kapasny State Health Institute, Zilina, Slovakia a, b Gabriela Slováková National Public Health Authority, Bratislava, Slovakia a Katarina Bitenc National Institute of Public Health, ... work package leader a Marita Afezolli Ministry of Health, Tirana, Albania a Lysien Ali Ministry of Health, Tirana, Albania a Nune Bakunts Ministry of Health, Yerevan, Armenia a Gerhard Fülöp Austrian...
Ngày tải lên: 12/02/2014, 12:20
Flooding in England: A National Assessment of Flood Risk doc
... authorities and internal drainage boards Local authorities Local authorities lead in reducing risks from development in the floodplain and management of drainage and small watercourses They will play an ... Protecting important national infrastructure and keeping essential services running 2.6 Flood forecasting and warnings 2.6.1 Detecting and forecasting floods 2.6.2 Warning and communicating about ... that have been effected by flooding Internal drainage boards (IDBs) IDBs are independent bodies responsible for land drainage in areas of special drainage need These are mostly low-lying areas...
Ngày tải lên: 28/06/2014, 19:20
preparing the patient for insulinshort
... International Diabetes Center Preparing the Patient for Insulin Overcoming Patient Resistance Behavioral issues • Taking insulin is inconvenient • Taking insulin is embarrassing • Taking insulin ... demonstrate insulin injection using sterile normal saline International Diabetes Center Preparing the Patient for Insulin Overcoming Patient Resistance Misinformation • Insulin means I have “serious” ... Preparing the Patient for Insulin Therapy • Understand natural history of diabetes and treatment options (SDM) International Diabetes Center Preparing the Patient for Insulin Therapy •...
Ngày tải lên: 12/08/2014, 20:58
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
... common disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence ... fracture site, allowing vascular regeneration and eliminating further damage to the peripheral and intramedullary blood supply which occurs during plate and screw fixation and intramedullary nailing ... as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic Surgery and...
Ngày tải lên: 20/06/2014, 04:20
báo cáo khoa học: "Successful one stage operation for a synchronous, duodenal carcinoma, colonic carcinoma and renal oncocytoma in an adult patient" pot
... (HNPCC) [11] Minniet al describes an increase incidence of small intestinal tumors; including duodenal adenocarcinoma, in patients with sporadic colonic malignancy [12] Data from 13 cancer registries ... Europe and Canada was analyzed in terms of incidence of second primary cancers following a diagnosis of small intestinal malignancy This study reported a 68% overall increase in the risk of a new ... Cite this article as: Faraj et al.: Successful one stage operation for a synchronous, duodenal carcinoma, colonic carcinoma and renal oncocytoma in an adult patient World Journal of Surgical Oncology...
Ngày tải lên: 09/08/2014, 02:21
A STUDY ON GROUPWORKS a TECHNIQUE USED IN TEACHING SPEAKING SKILL FOR THE 2ND –YEAR ENGLISH MAJOR STUDENTS AT HPU
... a wide range of competences with speaking in public, persuading and influencing others, making a case, chairing a meeting, sharing information 1.2 Types of Speaking In speaking class, according ... should find some information for their speaking activities It may be a paragraph, a magazine, a report, and a book…this show that, reading supports speaking by providing necessary information Students ... equate being able to speak a language as knowing the language and therefore view learning the language as learning how to speak the language , or as Nunan (1991) wrote, “success is measured in...
Ngày tải lên: 11/12/2013, 23:51
A study on communicative activities in english reading classes for the 10th from students
... natural learning Language learning requires the learners’ knowledge about many aspects of language such as vocabulary, grammar, pronunciation, etc In real language teaching, the teacher can not ... many sub skills just as involved in listening Reading is very important in real life in general and in language learning in particular “Reading may contribute significantly to competence in a ... activities are available, however, how and in what way to apply those activities in real teaching and learning English is still a question for many teachers The teaching practice at Thach Thanh II...
Ngày tải lên: 18/12/2013, 10:03
10 steps in developing a strategic social media plan for your business
... track Capture multiple analytics as some metrics may later become a better KPI af ter you have had the experience of measuring and analysing the data Roll out st rat egy Once you have f inalized ... of social media at solving that problem Choose a metric that’s indicative of that goal’s progress and is easy to measure Social media evolves rapidly so your tactics may have to change later T ... ten a great place to start) Discover opport unit ies Social media can be used f or a range of business activities including: Marketing Sales Customer service Research Analysis HR etc Within any...
Ngày tải lên: 07/01/2014, 15:27
The 10 Steps In Developing A Strategic Social Media Plan For Your Business
... goals and their associated KPIs will vary Speak with and analyse the requirements of each department and work out what level of resource is available f or social media # Def ine goals Analyse any ... buy -in f rom individual departments and management Add timelines and assign tasks Identif y and provide any required training/tools/supports Agree and manage roll out Only sign of f af ter the above ... cost of that tactic Thanks for reading our 10 steps in developing a strategic social media plan for business How would you go about developing a social media strategy? What would you add? Did...
Ngày tải lên: 08/02/2014, 20:25
Tài liệu Template for preparing a Storm Water Pollution Prevention Plan For Auto Salvage Yards pptx
... Ensure that fluid containers are securely capped and that funnels and drip pans are readily available Inside Parts Storage Area: Ensure drip pans are in place if necessary Inspect for leaks and spills ... draining Use drip pans, funnels, mechanical pumps, and hoses when removing and transferring fluids Drain parts and cores on a drain table or similar device before moving them to a storage area ... storm water discharge and monitoring points Label or number each point, for reference Also, outline the area that drains to each outfall and show the type of ground cover in each area (grass, pavement,...
Ngày tải lên: 17/02/2014, 10:20
Tài liệu Preparing a Business Plan: A Guide for Agricultural Producers doc
... publication is to provide farmers with business planning information and a format for developing a business plan for his or her farm business While information and sample business plans are available ... techniques is preparing the formal business plan A formal business plan integrates written goals with marketing, production and financial targets into a management strategy for the business along with ... will have an impact on achieving business goals 14 Goals Example , Mission To manage the farm as an efficient and profitable family-operated beekeeping business, maintain assets in good working...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Keep Your Shop in Tune A Best Management Practices Guide for Automotive Industries docx
... scrap paper Correctly manifest hazardous wastes Ask for and maintain a Material Safety Data Sheet (MSDS) on each chemical product used in your shop The Oregon Occupational Safety and Health Administration ... work area to a sewer without contacting your local sewerage agency Drain to a single sanitary drain when possible The drain may require an oil/water separator or an oil/grease trap 31 PARKING AND ... potential for site contamination • Join other automotive repair shops in Oregon that are taking pride in maintaining a clean and healthy environment Automotive Industry Wastes The individual sections...
Ngày tải lên: 19/02/2014, 04:20
Health education for microcredit clients in Peru: a randomized controlled trial potx
... non-linear, and that an attainment of a minimum threshold of age and educational status would be more important as a predictor variable than incremental effects would be Therefore age and educational ... N, Alcaraz GV, Schwarze S, Johannsen J: Developing Poverty Assessment Tools based on Principal Component Analysis: Results from Bangladesh, Kazakhstan, Uganda, and Peru International Association ... authors are grateful to Silvia Robles, Miguel Almunia, and Tania Alfonso for their roles in data collection and cleaning, as well as the surveyors, collaborating organizations, and study subjects for...
Ngày tải lên: 05/03/2014, 22:21
Management of pulmonary tuberculosis patients in an urban setting in Zambia: a patient’s perspective ppt
... University of Zambia UNZA), and Macro International Inc: Zambia Demographic and Health Survey 2007 Calverton, Maryland, USA; CSO and Macro International Inc; 2009 World Health Organization: “TB Country ... Prevention, Atlanta, GA, USA), with in- built consistency and range checks The database was converted to SAS® 9.2 (SAS Institute Inc., Cary, NC, USA) for recoding where necessary and final analyses ... TB/HIV Manual, Third Edition The National TB and Leprosy Control Programme Ministry of Health, Lusaka, Zambia Kaona FA, Tuba M, Siziya S, Sikaona L: An assessment of factors contributing to treatment...
Ngày tải lên: 06/03/2014, 04:20
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf
... 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ blue supercompetent cells (Stratagene) p26 cDNA inserts ... for each mutation p26 mutation R110G F112R R11 4A Y116D Primer 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ ... bovine a- crystallin to substrate ratio for protection against dithiothreitol induced denaturation ranges from : for insulin and a- lactalbumin, : for BSA and 10 : for ovotransferrin, with the ratio...
Ngày tải lên: 07/03/2014, 12:20
So, you want to go to grad school in Economics? A practical guide of the first years (for outsiders) from insiders pptx
... These are your main objective in the first year (after learning all the material, of course) Instructors don’t care if you got an A+ or a C- as long as you These are also known as core examinations, ... the institution In some cases you are allowed to repeat the examinations within a certain limit of trials (like in Minnesota) In others, failure to pass may mean being suspended from the program ... right? Think again Be ready to prepare at least 10 applications, maybe more, to get a decent shot at a program of your choice In economic lingo, you want to maximize the probability of being accepted...
Ngày tải lên: 08/03/2014, 05:20
Food and health in Europe: a new basis for action pdf
... Health Organization was established in 1948 as a specialized agency of the United Nations serving as the directing and coordinating authority for international health matters and public health ... disease and the importance of food F ood plays a hugely important role in causing and preventing many diseases Eating an inadequate range of foods can lead to deficiency diseases, and contaminated ... (http://www.codexalimentarius.net/, accessed 13 September 2002) has elaborated many international standards WHO assists in a range of food-related activities, including the setting of international standards for trade in food...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx
... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG ... 2a+ 2b+ 2– 3+wt 3+YIRN 3– TAATACGACTCACTATAGGGAGACCACAACGGTTTCC GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG GACTGCAaCCCCAAAtCGGACAG CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC ... GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGG Ó FEBS 2003 3020 P Prijatelj et al (Eur J Biochem 270) Vista, CA), digested with BamHI/HindIII (fragment 1, 60 bp), HindIII/EcoRI...
Ngày tải lên: 17/03/2014, 03:20