consider the structure and meaning of a sentence when punctuating it

... to the auditory one There is a high lexical density with a large number of content words and parataxis and low grammatical intricacy 3.4 Clause and Clause Complexes Analysis The analysis of the ... to analyzing the meaning and structure of a Vietnamese text, descriptive and analytical methods are used The former is concerned with the description of the main areas of functional grammar and ... formal grammar which focuses on written language and deals with rules of correct usage rather than with meaning and context of the text, functional grammar centers on both written and spoken language...

Ngày tải lên: 28/02/2015, 11:54

... prevented the acquisition of ROA data of suf®cient quality for reliable analysis A ROA spectrum of rather poor quality of an impure commercial sample of a- casein (composition unde®ned) was reported ... j-casein was prepared by adaptation of two other methods, each of which employs an acid precipitation stage to isolate the whole casein, a calcium precipitation stage to partially separate the ... contain substantial amounts of the PPII helical conformation (see below), these b- and jcasein ROA bands are therefore assigned to PPII structure The positive ROA bands in b- and j-casein at »...

Ngày tải lên: 21/02/2014, 15:20

... (data not shown) indicates the absence of any structural perturbation caused by the mutation Aminoacid analysis of the SDTG-modified Phe51Ala mutant and determination of its total amino and carboxy ... particular, the mean B-factors of Met121 at ˚ ˚ the A and B chains are 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms are 38.14 A ively It is therefore reasonable to ... in the PCRs were as follows: Phe51Ala mutation, 5¢-CGGAACCCCGCAGGTCGAGTTTCC-3¢ and 5¢-GA CGAGGTGCTCGGGGCTCTT-3¢; Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC-3¢ and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG-3¢...

Ngày tải lên: 16/03/2014, 16:20

... chloroplast ultrastructure, and leaf characteristics of high- and low-light plants and of sun and shade leaves Photosynth Res 2, 115-141 light E.M (1986) Correlation of activity and amount of ribulose ... low rates of C0 A uptake recorded (Fig 2A) were possibly caused by decreased availability of excitation energy in the canopy and not by altered organization of thylakoid membranes Later in the ... ultrastructure was analyzed from the electron micrographs as described by Aro et aL, (1986) and Vapaavuori (1986) On an average, typi- cal chloroplasts were analyzed sample of the replicate plots...

Ngày tải lên: 09/08/2014, 03:24

... read from the node and contained in a buffer (mRNA) After post editing of the pre mRNA, the addition of a 5’ cap and poly (A) tail to the mRNA now allows this data package to become part of a ... access of biological information via the DNA transcription machinery One of the limitations of the Central Dogma (and, for that matter, the abstract description of a digital computer as a Von Neumann ... servo head As the disk rotates, a new bit (flux boundary) travels across the receiving boundary area of the servo head and the data are read In the DHD, the DNA can be considered to remain relatively...

Ngày tải lên: 13/08/2014, 16:20

... representational meaning may be called transitivity The part of grammar that relates to interpersonal meaning may be called mood And the part of grammar that captures the organization of message may ... situation, that the situation has an impact on the nature and the meaning of the language used and that any account of language must therefore include reference to that context of use With the ... analysis and the framework of systemic-functional grammar As a way of start, we will take a look at the notions of genre, and genre analysis made as they are understood by scholars such as Jamieson...

Ngày tải lên: 31/03/2015, 14:14

... representational meaning may be called transitivity The part of grammar that relates to interpersonal meaning may be called mood And the part of grammar that captures the organization of message may ... situation, that the situation has an impact on the nature and the meaning of the language used and that any account of language must therefore include reference to that context of use With the ... analysis and the framework of systemic-functional grammar As a way of start, we will take a look at the notions of genre, and genre analysis made as they are understood by scholars such as Jamieson...

Ngày tải lên: 31/03/2015, 14:34

... of each of the five phases is shown separately Sprite LFS has a higher write bandwidth and the same read bandwidth as SunOS with the exception of sequential reading of a file that was written randomly ... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database ... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved...

Ngày tải lên: 12/09/2012, 15:05

... are available for some systems, such as temperate lakes and streams and the surface waters of temperate oceans, than for others, such as tropical lakes and streams and the abyssal depths of the ... gorgonians have a growth form that allows the surface area of their feeding apparatus to increase at a rate proportional to their mass rather than their surface area as might be expected of animals whose ... (1.2) Data and analyses from Savage et al (2004b) other extrinsic factors, but birth and death rates must match, and the rate of production must offset the rate of mortality for a population to...

Ngày tải lên: 17/02/2014, 19:20

... describe the structure and dynamics of each protein, and present a comparison of sbwAFP and TmAFP with each other and with proteins that have a similar fold Structure of sbwAFP and TmAFP The structure ... examination of the structure and sequence of sbwAFP and TmAFP reveal other similarities (Fig 8C) The panel shows the similarity of the TXT face again, and also reveals the presence of two Thr flanking ... Conclusion Analysis of the structure and examination of the ice-binding behaviour and point mutants of sbwAFP and TmAFP provides an explanation for their hyperactivity compared to the previously characterized...

Ngày tải lên: 19/02/2014, 16:20

... registration, location, and actiThe CORBA Event Service model simplifies application vation; request demultiplexing; framing and error-handling; parameter marshalling and demarshalling; and operation ... Facades that actively acquire data from the Sensor Proxies If data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction ... guaranteed that its deadline will be met, based on the published parameters of each schedulable operation One advantage of our approach is that operation invocations only pay the overhead of the C++...

Ngày tải lên: 19/02/2014, 18:20

... the problem A third kAad oF arguaen5 atruoSure we have ideaS%Fled 18 railed "ende-moane"t %P erase S oooure, then there ~e an aotAen A to set 5o seal O ?herefore eesamLAah orate S am a eubleal ... so+lYe a oct+sAn aununS, with a oor~aAn smotmt oF nalIAenoln, and ~he more oaIAent a preoeaa As, 5he lar|er %5e %npae5 on oSher presences (and therefore on the o v e r a l l prooeaoLng) 1, -qLa~in{ilqnv; ... left and eaten So beth mAeeloaar~oe oeme book " One XntoreatAng ~Ant about 5h ~a ~ r t ~ e ~ a r example %8 5hat ~t %e embeddedwlthAn an "el~mlnatAon of alternat£voo" arll~Nnt etruoture The5 %a, ...

Ngày tải lên: 21/02/2014, 20:20

... structure The mutation sites are displayed as side chains and located in domain III, domain V and the interface of domains G, III and V (B) Mutation sites in domain III that may affect the FA-binding ... domain IV (C) Mutation sites in helices AV and BV at the surface of domain V Gly621 and Gly617 are in the area of contact with the 1095 and 2473 regions of 23S RNA The two helices are facing the ... Helices are alphabetically ordered within each domain, and labeled with the domain subscript b-Strands are numbered within each domain, and labeled with the domain subscript A, mutations influence the...

Ngày tải lên: 06/03/2014, 22:21

... Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, ... Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria 2 2 2 2 ... secondary structure characteristics of transthyretins and TLPs are indicated above the alignment: motifs A –C’ are indicated with straight lines and are labelled; b-strands are indicated with arrows...

Ngày tải lên: 07/03/2014, 00:20

... Leaf area is measured as the leaf area index (LAI), this is the ratio of the area of leaf to the land area For example, a crop with an LAI of 1.5 has 1.5 square metres of leaf for each square ... enclosed within a lemma and a palea Within these enclosing structures there is a carpel which consists of the ovary with the feathery stigmas, and three stamens bearing the pollen sacs or anthers These ... season rainfall as an estimate of crop water use and a target WUE was expanded to include the water-limited yield potential of a crop and better seasonal estimates of water use and WUE 62 CHAPTER...

Ngày tải lên: 08/03/2014, 23:20

... CAGCCC and CGCGAATTCTCACACTGGCAAGC ACCGAGGAATCT; CCP1CCP2: CGCGCTAGCATGATCATCAAGTGCC CCCAGCCC and CGCGAATTCTCACACTGGCAA GCACCGAGGAATCT; CUB2CCP1: CGCGCTAGCATGACTCAGGCTGAG TGCAGCAGC and CGCGAATTCTCAGTCCTTGA ... CGCGAATTCTCAGTCCTTGA TCTTGCATCTGGG; CUB2CCP1CCP2: CGCGCTAGCATGACTCAGGCT GAGTGCAGCAGC and CGCGAATTCTCACACT GGCAAGCACCGAGGAATCT The PCR products were digested with NheI and EcoRI (cleavage sites underlined) and ... subunit, a modular serine protease In an extraordinary example of ‘action at a distance’, an activation signal is then mechanically transmitted to two molecules of C1r that are located within the...

Ngày tải lên: 15/03/2014, 23:20

... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database.In Proceedings of the International Conference ... common databaseutilities that all E-ADTs can use Code methodsthat may be inyoked on valuesof that type An ADT to handle arithmetic and booleanexpressions,constantvalues can itself be a structured ... that maintain statisticsand storeschemainformation Further, certain valuesmay be named Query Language: An E-ADT can provide a query language with which expressionsover values of/ that E-ADT can...

Ngày tải lên: 16/03/2014, 16:20

... (where Ao and At are the intensities of the band of intact protein at the beginning of trypsinolysis and at the fixed time of trypsinolysis) against the time of incubation (Fig 8D) The apparent rate ... and in Fig 9) Heating of rhodanase at 43 °C induces its denaturation, which is followed by aggregation The wildtype HSP22 and its mutants decreased the rate of rhodanase aggregation and the amplitude ... [33], the wild-type HSP22 and its mutants migrated as a single band with an apparent molecular mass of approximately 60 kDa (data not shown), thus indicating that, under these conditions, HSP22 and...

Ngày tải lên: 23/03/2014, 07:20

... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); Pfg27C: 5¢-AAAAAGC...

Ngày tải lên: 23/03/2014, 21:20

Ngày tải lên: 23/03/2014, 22:21