conformation dynamics of biotin repressor

... contribution of each mode toward the dynamics of the whole protein 45 xiii Figure 3-8 Percentage contribution of each mode toward the dynamics of interfacial residues around the point of ... in molecular dynamics (MD) simulations, and methods of analysis of structure and dynamics A brief discussion of the temporal variations of root mean squared displacements (RMSD) of all the atoms ... DNA The choice of a minimally restructuring protein allows one to isolate and examine the issues of interest (here, the intrinsic dynamics of the protein, water dynamics and DNA conformation) ...

Ngày tải lên: 09/09/2015, 18:49

... an example of the use of these equations, a study of the dynamics of aeolian sand ripples [216] 11.3 Case A: the Edwards–Wilkinson equation with flow The first model involves a pair of linear coupled ... discussion of three models of sandpiles, all of which manifest asymptotic smoothing: Cases A and C manifest this in the species h of stuck grains, while Case B manifests this in the species ρ of flowing ... the presence of a finite density ρ of flowing grains The analysis of Case A is straightforward, and was undertaken really only to explain features of the more complex Case C; that of Case B shows...

Ngày tải lên: 01/11/2013, 08:20

Ngày tải lên: 12/01/2014, 21:44

... the behavior of a single degree of freedom (SDOF) structure will be discussed, and then this will be extended to a multi degree of freedom (MDOF) structure The number of degrees of freedom is ... Dynamics of Structures, Prentice Hall, N.J., 1995 HUMAR, J L., Dynamics of Structures, Prentice Hall, N.J., 1990 PAZ, M., Structural Dynamics, Chapman & Hall, New York, 1997 Introduction to Dynamics ... each of the two modes • Discuss the advantages and disadvantages of these two methods? 5.0 References CHOPRA, A K., Dynamics of Structures, Prentice Hall, N.J., 1995 HUMAR, J L., Dynamics of Structures,...

Ngày tải lên: 12/01/2014, 22:16

... ) ∈ N The orbit of a pair of forms of genus one under the action of NI is isomorphic to the orbit of a point x ∈ (G × G)/(Γ × Γ) under the action of N∆ By the classification of unipotent orbits ... Ω1 ED (1, 1) Theorem 8.5 The space of eigenforms Ω1 ED (1, 1) has finite volume Proof The proof follows the same lines as the proof of finiteness of the volume of Ω1 M2 (1, 1), using the fact that ... surface Proof of the Corollary The limit set of Γφ is the full circle S∞ [Mc2], and f (Vφ ) is the projection of the SL2 (R)-orbit of an eigenform (by Theorem 5.8 below) Thus we are in case (1) of Theorem...

Ngày tải lên: 16/02/2014, 06:20

... of the bank-specific variable αi of those banks for which there is an observation in month t As the composition of this sample changes in the course of time, the cross-sectional average α(t) of ... transformation, and the dynamics of the term structure1 Introduction For many banks, term transformation represents a substantial part of their interest income This is especially true of small and medium-sized ... choose the following method of mitigating the problem of changing sample composition: Instead of the exposure levels Xi (t), we investigate the change in the exposure of the same bank, as stated...

Ngày tải lên: 16/02/2014, 06:20

... importance of official flows has decreased relative to other sources of financing First, net private flows now represent more than 90% of total financial flows Despite periods of upsurge of official ... and main conclusions of an ongoing research program at FORO Nacional Internacional The main objective of the program is to identify long-term trends and dynamics of the system of international development ... Annual reports of institutions THE DYNAMICS OF MULTILATERAL DEVELOPMENT BANKS IN LATIN AMERICA AND THE CARIBBEAN There are no common metrics to assess the level of decentralization of the MDB system...

Ngày tải lên: 16/02/2014, 06:20

... Preparation of the appendices in Dynamics of Human Gait was done by Mrs Cathy Hole, information specialist, and Ms Narima Panday, senior secretary The desktop publishing of the whole of Dynamics of Human ... development of GaitLab, took place in June and July of 1988 in Cape Town We especially thank Dr George Jaros, professor and head of the Department of Biomedical Engineering at the University of Cape ... Williams & Wilkins Reprinted by permission DYNAMICS OF HUMAN GAIT Top-Down Analysis of Gait Dynamics of Human Gait takes a top-down approach to the description of human gait The process that we are...

Ngày tải lên: 17/02/2014, 19:20

... Olsson Professor of Business Administration Darden School of Business, University of Virginia Jared Harris Assistant Professor of Business Administration Darden School of Business, University of Virginia ... three core dynamics of trust harm and to protect persons from harm in the case of collisions The Three Core Dynamics of Trust—Putting the Paradigm into Action The three core trust dynamics identified ... three core dynamics of public trust in business are Mutuality, Balance of Power, and Trust Safeguards Mutuality is the state of affairs where multiple parties seek to pursue courses of action...

Ngày tải lên: 18/02/2014, 00:20

... subunit A of crystal form II and in subunit B of crystal form III, both in the absence of NAD+, as well as in subunit D of crystal form I in the presence of NAD+ C Fig Crystal structure of P putida ... shorter in PpHBDH because of a deletion of residues Moreover, the substrate-binding loop of PpHBDH is one residue shorter that that of PfHBDH, because of a deletion at the end of helix aFG1 In human ... and the structure of the cosubstrate-binding pocket of PpHBDH are very similar to those of PfHBDH, with a distance of about ˚ 14 A between the C2 of nicotinamide and the C6 of the adenine ring...

Ngày tải lên: 18/02/2014, 16:20

... (FRAP) are often used to assess the dynamics and kinetic properties of proteins in living cells [1219] FCS detects the uctuations of uorescent intensity derived from the movement of a single ... 0.8 0.6 0.4 0.2 min Fig Time-lapse LSM analysis of OlvasGFP reveals the dynamic nature of the nuage Schematic diagram of the preparation of PGCs of medaka specimen (A) OlvasGFP was expressed in ... suggesting the existence of some interactive cellular partner FRAP analysis of the nuage revealed the slow recovery of OlvasGFP (Fig 3B) When the whole part of the single compartment of nuage was bleached,...

Ngày tải lên: 18/02/2014, 16:20

... participants with the images of car exteriors spanning a long period of time The specific usage of historic views of design-oriented objects such as cars should provide a sensitive test of how the design ... encounter complex dynamics of our Formensprache throughout a lifetime From a cognitive psychological perspective, it is of relevance which specific processes such dynamics might trigger First of all, from ... changing the overall appreciation of a car and thus the basis of triggering dynamics in preferences, we should find no substantial change in the overall pattern of design evaluations through the...

Ngày tải lên: 19/02/2014, 17:20

... ratio ˜ Uw of the actual number of users of word w (Uw ) over ˜ the expected number of users of w (Uw ), and DT = Tw ˜ is calculated analogously fo the actual/expected Tw ˜ ˜ number of threads ... precision of 70% (per type: 67%) at 95% recall, a gain of 7% (9%) over the baseline Our system identified 1,415 anglicism candidate types with a corpus frequency of 100 or greater, out of which ... Because of the possibility of multiple prefixation or suffixation (e.g rum-ge-battle (‘battling around’) or deep-er-en (‘deeper’)), we stripped sequences of two prefixes and/or three suffixes Our list of...

Ngày tải lên: 19/02/2014, 19:20

... concentration of 0.4 mgặmL)1 and at vefold molar excess of Tc per mol of the dimer The denaturation enthalpy values of the proteins (in the absence and presence of ligand) as a function of scan rate ... rate of Kặmin)1 (Figs and 2) Therefore, under these experimental conditions, binding of Tc causes an increase in the Tmax of the protein of % 10.0 C The ligand binding leads to a doubling of the ... value (Table 1) Effect of the scan rate Thermal denaturation of TetR was carried out at a protein concentration of 0.6 mgặmL)1 and scan rate (v) of 0.12.0 Kặmin)1 Measurements of liganded protein...

Ngày tải lên: 20/02/2014, 02:21

... secondary structures of the repressors of S aureus phages show a notable similarity to that of k repressor, especially at the C-terminal ends As noted with the C-terminal end of k repressor [1], the ... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig ... C-terminal ends of the repressors of S aureus phages may be involved in oligomerization The N-terminal half of /11 repressor carries a putative helixturn-helix DNA binding motif similar to that of lambdoid...

Ngày tải lên: 07/03/2014, 00:20

... and dynamics of eRF1 middle domain A B Fig 1H,15N-HSQC spectra of the M domain of human eRF1 The numbering of the residues corresponds to that of the full eRF1 protein (A) The Gly region of the ... implications of the behavior of this loop The first is the facilitation of the conformational rearrangements and the maintenance of the conformational plasticity for effective binding of the protein ... of the NMR family of solution structures of the M domain of human eRF1 Fig S3 A surface representation of the M domain of human eRF1, mapping the electrostatic potential Fig S4 A comparison of...

Ngày tải lên: 07/03/2014, 05:20

... characteristics of the 275–284 segment of hHR23B Because of the high quality of our 15 N-HSQC spectra, 54 of the 58 protonated backbone nitrogen atoms were available for relaxation measurements The values of ... (25 instead of 27 °C), which gives better HSQC spectra Because of the known dependence of the overall correlation time sc on the molecular size of various proteins [23], both sc values of the XPCB ... The N-terminal part of XPCB–hHR23B B C Fig NMR structure of the XPCB domain of hHR23B (A) Stereoview of the 12 superimposed structures of XPCB–hHR23B All Pro residues conserved among the STI1...

Ngày tải lên: 07/03/2014, 17:20

... C of 28.8 0.9 kJặ mol)1, from which a DH of 143 23 kJặmol)1 and DS of 0.34 0.07 kJặK)1ặmol)1 can be derived In the presence of DGP an average DG of 30.4 0.9 kJmol)1 was found, and a DH of ... exibility of the N-terminal region of the protein The difference of S2 values in the presence and absence of solute are shown in Fig Overall, the average S2 values tend to be higher in the presence of ... the DG of the structural opening ể FEBS 2003 Eect of DGP on rubredoxin dynamics (Eur J Biochem 270) 4611 Upon solute addition a stabilization of RdDg took place and an average positive DG of 1.6...

Ngày tải lên: 07/03/2014, 21:20

... Magnification of aH secondary chemical shifts of residues from different CCP modules Fig S10 Set of HSQC spectra of CCP1CCP2 (#2) collected at 280, 300 and 320 K at pH 4.0 Fig S11 Set of HSQC spectra of ... S12 Overlay of HSQC spectra collected at 300 K of single CCP1 and CCP2 and of pair of modules at neutral and acidic pH Doc S1 Intermodule cooperativity in the structure and dynamics of consecutive ... NH flexibility is typically given in terms of the square of the generalized order parameters, S2, as the rate of physical restriction of NH motion, and of effective correlation time, se, on the...

Ngày tải lên: 15/03/2014, 23:20