configuring and managing web servers using iis

... 10-44 Lesson 3: Configuring and Managing Web Servers Using IIS 10-46 Installing IIS 6.0 10-46 Administering the Web Environment ... 10-46 Configuring and Managing Web and FTP Sites 10-47 Contents xxi Backing Up IIS Configuration 10-50 Securing Files on IIS ... World Windows Server 2003, Web Edition Windows Server 2003, Web Edition, was developed specifically for the deploy­ ment of Web pages, Web sites, Web applications, and Web services Based on its...

Ngày tải lên: 01/06/2014, 09:32

... deployment of Web pages, Web sites, Web applications, and Web services Web Edition supports gigabytes (GB) of RAM and a two-way symmetric multiproces­ sor (SMP) It provides unlimited anonymous Web connections ... 6-38 Installing IIS 6.0 6-38 Administering the Web Environment 6-38 Configuring and Managing Web and FTP Sites ... Prepare for the Exam Managing and Maintaining Physical and Logical Devices (1.0) 14-3 Managing Users, Computers, and Groups (2.0) 15-1 Managing and Maintaining Access...

Ngày tải lên: 03/06/2014, 02:09

... transfected using OPTIMEM and Lipofectamine, cells were lysed on the dishes and immunoprecipitated as indicated Antibodies Four mAbs against human CD53 were used, MEM53 (IgG1) isotype) [47], and 202–24b, ... GST–Jun and GST– ATF2 as substrates and the activity was determined in the anti-HA immunoprecipitate The controls for transfection and immunoprecipitation was determined by a Western blot using ... containing the GAL4 DNAbinding domain and the c-Jun activation domain (residues 1–223) in wild-type and mutant forms (not phosphorylatable by mutation of both serines 63 and 73 to alanine) These plasmids...

Ngày tải lên: 08/03/2014, 22:20

... for h and the immunolabelled bands were detected using a SuperSignal West Dura (Pierce) All band densities were measured as densitometric unitsÆ lg)1 total proteins using the image analysis and ... intracellular free Ca2+ and ROS, mitochondrial status, cytochrome c and AIF release, Bcl-2 expression, and caspase and caspase activation support different scenarios in the response of Hend and IMR90 cells ... increasing slowly between and 24 h In contrast, in IMR90 cells the Ca2+ increase was much smoother and smaller, and without an early peak The data suggest that the more vulnerable Hend and more resistant...

Ngày tải lên: 16/03/2014, 13:20

... surface and (c) the atomic concentration ratio of Ga, As, and O atoms in intrinsic GaAs Ox was analyzed by AES analysis, and the results indicate that Ga(As)Ox contains both Ga O and As O and the ... for the GaAs samples with different doping types and plane orientations, as a function of applied voltages (5 and 15 V) and loading forces (60 and 180 nN) It can be observed that the oxide height ... is expected that the H+ and OH- ions generated at the GaAs surface and an AFM probe will recombine immediately according to the recombination reaction in water and Ga2O3 and As2O3 are formed on...

Ngày tải lên: 20/06/2014, 22:20

... understanding teacher burnout In Understanding and preventing teacher burnout Edited by: Vandenberghe R, Huberman M NY: Cambridge University Press; 1999:159-65 12 Farber BA: Understanding and Treating ... summarise the categorical variables and the c2 contrast test to assess differences in percentages Means, standard deviations, medians, interquartile ranges and minimum and maximum values were utilised ... utilised to describe the distribution of data collected using the BCSQ-36 scales and subscales Maslach and Jackson [43], followed by Maslach, Jackson and Leiter [44], considered burnout dimensions to...

Ngày tải lên: 11/08/2014, 15:22

... the operation and drafted the manuscript GD was involved in postoperative follow-up AT and NK were involved in postoperative follow-up and drafted the manuscript All authors read and approved ... incidentally during routine ultrasound examination and the discrimination between RCC and oncocytoma based solely on radiologic criteria, including CT and/ or MRI, is not always possible Therefore, ... contrast) and left (b, d: post contrast) renal tumors We need to acknowledge that the follow-up period of 14 months is limited and that the patient is still at risk of local tumor recurrence and disease...

Ngày tải lên: 11/08/2014, 17:21

... fused and resemble the whorl I organs in shape, color and stability SEM of the abaxial and adaxial epidermis structures (n = varieties each) of whorl I and whorl II organs in both the wild-type and ... isolated using a modified protocol of the RNeasy Plant Mini Kit ([37], Qiagen) and subsequently reverse transcribed to first strand cDNA (Reverse Transcription System, Promega) using a standard ... molecular methods and the experiments, performed the sequence alignments and all other genetic and molecular data analysis, captured the macroscopic, histological and SEM images and drafted the...

Ngày tải lên: 12/08/2014, 03:21

... mixed-ability understand the reading texts to synthesis, evaluation and appreciation levels As teachers we need to be good at making questions with different levels of understanding and our responsibility ... 12, page 32) To test and help learners’ understanding why the author uses a certain piece of information and to ask learners about the development of the passage To test and help learners’ ability ... have new policy in teaching and learning English and assessing the students’ communicative competence required by the Misnistry of Education and Training The study on using different qustion types...

Ngày tải lên: 17/07/2015, 20:39

... fabric, and travelling on tracks Mechanical Finishing Raising Napping Using wire-covered rolls to "dig out" individual fiber ends to the surface Sueding Using abrasive-covered rolls (sandpaper, ... The process which is used to remove loose threads and short fbre ends from smooth-surfaced fabrics and is also used to raise a nap on knits and woven fabrics is called Brushing Brushing is frequently ... Tentering, These are fnal processes applied to set the warp and weft of woven fabrics at right angles to each other, and to stretch and set the fabric to its fnal dimensions Tentering stretches...

Ngày tải lên: 30/07/2015, 10:32

... there again and again The process through which shoppers make decisions related to the utilization of their time, money and efforts in order to procure, use and dispose off goods and services ... hence inability to handle them differently They use the same sales presentation, same sales tactics and same strategies with each and every customer with whom they interact and therefore they ... ability to perceive consumer differences and using them to modify your sales talk will not ensure that you will be able to convince and convert each and every customer that moves into your store...

Ngày tải lên: 19/02/2014, 10:20

... sometimes highlight physical shape and face Correlations between DDS and O groups, and DDS and P groups were not statistically significant Nevertheless, DDS and P groups correlation coefficient ... Mexican female and male profiles are as follows: M1 and F3 (bi-maxillary protrusion) These represent profiles with an advanced degree of upper and lower alveolar segments with upper and lower increase ... (M4) and bi-maxillary retrusion (M7, P: 001) Paired comparisons showed that O placed M2 in a worse position than DDS and P DDS assessed M3 as the least attractive when compared with O and P DDS and...

Ngày tải lên: 19/02/2014, 17:20

... min, and subjected to SDS ⁄ PAGE electrophoresis and phosphor-imaging Positions of monomers are indicated by white circles, and lower and higher levels of homotrimers are indicated by gray and ... (synthetically defined tryptophan and histidine dropout medium) and SD-WH + mM 3-AT and WH + mM 3-AT (synthetically defined tryptophan and histidine dropout media with and mM of 3-AT) The lane with ... contained exclusively the P-, G- and S-type HSEs, respectively; 59 genes showed both P- and G-type HSEs, 56 genes a combination of P- and S-type HSEs, while G- and S-type HSEs were noted together...

Ngày tải lên: 05/03/2014, 23:20

... and III were 29.3 and 11.5%; and 23.4 and 11.2% respectively It could be seen that the number of symptomatics without cough and chest pain but with fever of one month or more was negligible and ... a previous history of treatment and they contributed 30 (11.4%) cases The corresponding proportions in the subsequent two surveys were 9.7 and 16.0%; and 14.4 and 17.3% respectively The yield ... months, months to < 12 months and > year respectively In survey II, the corresponding proportions were 26.0, 29.0 and 45.0% and that in survey III were 44.4, 32.3 and 23.4% respectively On an...

Ngày tải lên: 06/03/2014, 04:20

... calculated including (1) the term candidate relevance, CC; (2) the candidate to sentence relevance, CS; and the candidates to document relevance, CD Terms are then verified by using different types of ... Candidates and Sentences A domain specific term is more likely to be contained in domain relevant sentences Relevance between term candidate and sentences, referred to as CS, is calculated using ... vector VA and VH are initialized to (1, 1,…, 1) Given weights VA and VH with a directional link p → q, w(q)A and w(p)H are updated by using the I operation(an in-pointer to a node) and the O...

Ngày tải lên: 08/03/2014, 01:20

... udeD(1)319)-yfp-pIZ and udeD[1)319(350AAAA353)]-yfp-pIZ were generated by PCR amplification using UDEd1-319-For (5¢-CTAGCAAGCTTA CCACCATGGCGCCCGAAAAGCGCAAGCAGGAG-3¢) and yfp-Rev as primers, and Udewt-yfp-pIZ and ... Restriction enzymes, T4 DNA ligase and DNA polymerases were from Fermentas (Ontario, Canada), New England Biolabs (Ipswich, MA, USA) and Finnzyme (Espoo, Finland), respectively The pIZ ⁄ V5-His ... ACGC-3¢) and yfp-Rev (5¢-GCTCTGCTCTAGACTCGAG TCACGCTTGTACAGCTCGTCCATGC-3¢) Each PCR product [udewt-yfp, udeD(346)355)-yfp and udeD(316)355)yfp] and the empty pIZ vector were digested using HindIII...

Ngày tải lên: 15/03/2014, 11:20

... isolated and digested with EcoRI and PstI as previously reported [17] The probes were the full lengths of Japanese flounder hepcidin cDNA fragments and were labeled with [32P]dCTP[a P] using a random ... cell and both positive cells, respectively Antimicrobial and hemolytic activity of hepcidin Both Hep-JF2pep and Hepc20 have antimicrobial activities against Gram-negative Escherichia coli, and ... garvieae, and S iniae were achieved with 25, 50, 50, 100 and 12.5 lm concentrations of Hep-JF2pep, respectively (Fig 7) Similarly, over 90% killing of E coli and S aureus were also achieved with 25 and...

Ngày tải lên: 30/03/2014, 20:20

... only be achieved by holding both shoulder blades to the mat for three seconds Throws are takedowns and are only two points Wrestling is very exhausting sport even though it is only six minutes long,...

Ngày tải lên: 02/04/2014, 18:00

... water overnight, the water will cause the handle to expand and tighten in the head If a hammer tends to slip off nails, roughen the face of the head using a medium abrasive paper Always wear safety ... with rounded body; Veneer Hammer, for pressing and tapping veneers into place; Upholsterer's hammer for driving tacks and nails in confined spaces, and Sprig Hammer, used by picture frame makers ... duty nailers, used to fix floorboards and garden decking etc Advice for using hammers Always use the right hammer for the job, it will make the job easier and avoid possible damage to the hammer/workpiece...

Ngày tải lên: 14/04/2014, 11:28

... comparison of WR-GFP and MVA-GFP showed that both viruses infected a high percentage of CD14+ monocytes (83 and 70%, respectively), and a low percentage of T lymphocytes (0.46 and 0.2%, respectively) ... have important implications in understanding virus pathogenicity and immunogenicity Methods Cells, plasmids and virus Vaccinia virus strain WR was grown and titrated in BSC-1 or CV-1 cells, grown ... using oligonucleotides GFP 5' (AATATAAATGGCTAGCAAAGGAGAAGAA) and GFPH3 (TTTAAAGCTTTACTAGTGGATCCTCAG), that include NheI and HindIII restriction sites, respectively After digestion with NheI and...

Ngày tải lên: 18/06/2014, 22:20