computation of pseudocritical temperature and pressure of a natural gas

Combustion and emission characteristics of a natural gas fueled diesel engine with EGR

Combustion and emission characteristics of a natural gas fueled diesel engine with EGR

... mode This is because of the very lean mixture of gaseous-fuel and air at part load, and the associated poor fuel utilization efficiency In such a case, large portion of natural gas escapes from the ... BE, Casey RT Experiments and modeling of natural gas Cp ¼ð where (A0 ), (A1 ), (A2 ), (A3 ), and (A4 ) are constants, and their values are [28]: A0 ¼ 3:04473 A1 ¼ 1:33805 A2 ¼ 4:88256 A3 ¼ 8:55475 A4 ... natural gas diesel engine Energy 2010;35:1129–38 [11] Wannatong K, Akarapanyavit N, Siengsanorh S, Chanchaona S Combustion and knock characteristics of natural gas diesel dual fuel engine SAE paper...

Ngày tải lên: 15/06/2014, 09:26

12 573 0
THERMODYNAMIC PROPERTIES OF CERIA THIN FILM TEMPERATURE AND PRESSURE DEPENDENCES

THERMODYNAMIC PROPERTIES OF CERIA THIN FILM TEMPERATURE AND PRESSURE DEPENDENCES

... 0) and ainter (P, 0) We assume that the average nearest-neighbor distance of the surface layers and internal layers for cerium dioxide thin film at temperature T can be written as side side aside ... lattice constant and thermal expansion coefficient of ceria thin film using the potentials 1, and Butler potential Figs and show the lattice constant and thermal expansion coefficient of ceria thin ... i.e., parameters are adjusted, usually by a least-squares fitting routine, so as to achieve the best possible agreement between calculated and experimental crystal properties The potential parameters...

Ngày tải lên: 31/10/2015, 10:44

6 257 0
Báo cáo y học: "Whole genome sequencing of a natural recombinant Toxoplasma gondii strain reveals chromosome sorting and local allelic variants" ppsx

Báo cáo y học: "Whole genome sequencing of a natural recombinant Toxoplasma gondii strain reveals chromosome sorting and local allelic variants" ppsx

... II and III, predominate across Europe and North America [7,8] As data become available from wider geographical studies it is evident that higher levels of allelic variation and clonal expansion ... Phenotype of TgCkUg2 and clonal Ugandan isolates None of the Ugandan isolates caused morbidity or mortality in mice and could therefore be classified as avirulent Quantitative PCR (Q-PCR) of parasite ... quality of information generated and availability of the putative parental strains to this natural recombinant provide an excellent basis for a better understanding of the gene combinations responsible...

Ngày tải lên: 14/08/2014, 21:20

17 324 0
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

... Characterization of flavonoids on PPARα and PPARγ activity 103 3.3 Characterization of flavonoids and PPARα ligands on a natural PPARα V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... 2004 at Shanghai International Convention Center, Shanghai, China xiv ABBREVIATIONS 15dPGJ2 Å3 ABCA1 ACO Acrp30 AD AF-1 AF-2 AM aP2 apoA-I apoA-II apoA-V apoC-III AR bp Bio Cal CAP350 CARM-1 ... (Lefebvre et al 2006) 1.3.1 PPARα ligands PPARα is activated naturally by a wide variety of saturated (palmitic acid), monounsaturated FA (oleic acid) and polyunsaturated FA (PUFA) (linoleic acid, linolenic...

Ngày tải lên: 12/09/2015, 08:20

263 267 0
Carpets monsters and killer spores: a natural history of toxic mold

Carpets monsters and killer spores: a natural history of toxic mold

... but none of this had captured my interest until a black mold attacked my wife I had bought Diana a gift box of hand lotion, soap, and lip balm that trumpeted an all -natural, no-preservative pedigree ... by plants and animals: fats and oils, proteins, nucleic acids, and sundry molecules that keep cells alive or are minor parts of their substance (Speaking of animals, I’m happy to forecast a brief ... fungal way of life is a unique strategy for survival Their evolutionary history has set them apart from the animal use of a mouth and a stomach, and the plant’s solar-powered conversion of carbon...

Ngày tải lên: 27/05/2016, 00:05

191 330 0
Two dimensional numerical computation of a circulating fluidized bed biomass gasifier

Two dimensional numerical computation of a circulating fluidized bed biomass gasifier

... experimental data always favor gas heating value Too high a temperature lowered gas heating value According to the study of Mahishi and Goswami (2007), at low temperatures, solid carbon and CH4 are present ... evaluation The effects of the operational parameters such as gasifier temperature and ER on syngas composition of an atmospheric 249 biomass CFB gasifier has been investigated and has been also validated ... the gas and the wall The hydrodynamic model takes into account the axial and radial distribution of voidage and velocity, for gas and solid phase, A Gungor, U Yildirim / Computers and Chemical...

Ngày tải lên: 01/08/2016, 09:30

17 457 0
Design improvements and performance testing of a biomass gasifier based electric power generation system

Design improvements and performance testing of a biomass gasifier based electric power generation system

... Quantity and calorific value of fuel Quantity and calorific value of producer gas Ultimate and proximate analysis of fuel Gas analysis Gas temperature at various points Air temperature at various ... exit of gasifier Hot air supply for gasification Tar level in raw gas Tar level in clean gas Fuel storage capacity of the hopper Gas temperature at the inlet Gas temperature at the outlet Air temperature ... study, a detailed mass balance, energy balance and elemental balance of a biomass gasifier based power generation system was carried out The mass balance analysis was conducted to estimate and understand...

Ngày tải lên: 02/08/2016, 09:34

17 466 0
Báo cáo lâm nghiệp: "Conversion of a natural broad-leafed evergreen forest into pure plantation forests in a subtropical area: Effects on carbon storage" pps

Báo cáo lâm nghiệp: "Conversion of a natural broad-leafed evergreen forest into pure plantation forests in a subtropical area: Effects on carbon storage" pps

... Castanopsis kawakamii, and an adjacent relict natural forest of Castanopsis kawakamii (NF) that as a control, provided a unique opportunity to examine how changes occur following converting a natural forest ... (Cunninghamia lanceolata) plantation forest; FH, Fokienia hodginsii plantation forest; OX, Ormosia xylocarpa plantation forest; CK, Castanopsis kawakamii plantation forest; NF, natural forest of C kawakamii ... lanceolata (Chinese fir, CF), Fokienia hodginsii (FH), Ormosia xylocarpa (OX) and Castanopsis kawakamii (CK) that grown on a same soil and with the same former forest, natural forest of Castanopsis...

Ngày tải lên: 08/08/2014, 00:22

10 384 0
Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps

Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps

... 5’ACTAGTGTTGGATCCTAACAACGTTCGGCATGGAGCTAGGTATAGCAGTAGCAAATATGGATGTAAAACTACAGATAG-3’, 2) the mutant designated VRB3aa using primer 5’-GAGGGAGTAATCAGGACAATAGCTGCACAGGAAAATGCAACCCCC-3’, 3) the mutant designated N147S using primer 5’-GGGAGTAGTCAGGACAATAGCTGTGAGGG-3’, ... indicated primers where the introduced mutation in each case is underlined: 1) the mutant designated 61E/945-5 using primer 5’ACTAGTGTTGGATCCTAACAACGTTCGGCATGGAGCTAGGTATAGCAGTAGCAAATATGGATGTAAAACTACAGATAG-3’, ... prototype FeLV -A isolates FeLV -A/ 61E [GenBank:AAA93093], FeLV -A/ 3281 [GenBank:AAA43051] and FeLV -A/ Glasgow [GenBank:AAA43053], from FeLV-945 [GenBank:AAT76450] and from other representatives of the cohort...

Ngày tải lên: 13/08/2014, 01:20

17 267 0
Modeling and optimization of liquefied natural gas process

Modeling and optimization of liquefied natural gas process

... flash gases (HPFG), boil-off gases (BOG), end flash gases (EFG), etc are the tail gases that contain substantial amount of methane in base-load LNG plants 24 Chapter Literature Review Most of ... various parts of an LNG plant and demonstrates significant savings in operating and energy costs Finally, the global optimization of bilinear and nonconvex design and operational problems is addressed ... The mass and energy balance equations in HENS and FGNO for LNG would involve products of two decision variables such as temperature and flow rate, enthalpy and flow rate, flow rate and quality,...

Ngày tải lên: 14/09/2015, 08:45

215 556 0
Labour and the Environment: A Natural Synergy pptx

Labour and the Environment: A Natural Synergy pptx

... eradication of labour-related and environmentally aggressive actions in third countries and the defence of decent work standards and health and safety protection measures at the workplace and ... of union activities were to make the Malaysian-owned Ramatex company comply with international standards and national laws, and to bring about change and improvements at the local factory level ... resources Employee awareness of relevant environmental standards and company policies plays an important role in Rhodia’s approach at both the international and local levels Rhodia and ICEM will combine...

Ngày tải lên: 28/06/2014, 19:20

152 293 0
Báo cáo lâm nghiệp: "C and 15 N isotopic fractionation in trees, soils and fungi in a natural forest stand and a Norway spruce plantation" pps

Báo cáo lâm nghiệp: "C and 15 N isotopic fractionation in trees, soils and fungi in a natural forest stand and a Norway spruce plantation" pps

... Discrimination among ectomycorrhizal sporophores in the Breuil forest according to δ13 C and δ15 N, (A) natural stand, all sporophores, (B) natural stand, mean and standard deviation for each genus: Ama ... investigate the ways of nitrogen and carbon acquisition by both fungal types in a natural mixed forest stand and a Norway spruce plantation, situated in the centre of France, by using 13 C and 15 N natural ... Norway spruce plantation, all sporophores, (D) mean and standard deviation for each genus: Ama = Amanita, Bol = Boletus, Cant = Cantharellus, Chal = Chalciporus, Clav = Clavulina, Cor = Cortinarius,...

Ngày tải lên: 07/08/2014, 16:21

11 319 0
 Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

... the chaotic properties of natural phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of traditional analyses [1] A strong reason behind this paradigm ... original data can be considered appropriate Recently Parkinsonian patients (PP), spinocerebellar ataxia (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension ... the acknowledgment of variability in natural systems to be healthy and, in fact, desirable In other natural systems such as control of heart rate, heartbeats not occur at regular intervals but at...

Ngày tải lên: 03/11/2012, 10:09

10 458 0
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

... southern Asia, and it is a staple food for a large part of the world’s human population especially in east, south and south-east Asia, making it the most consumed cereal grain Rice bran oil is extracted ... 349 Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering ... timing and injection pressure were evaluated as 21°CA bTDC and 230 bar respectively References [1] Crookes RJ, Kiannejad F, Nazha MAA Systematic assessment of combustion characteristics of biofuels...

Ngày tải lên: 05/09/2013, 16:11

10 552 0
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

... dramatically altered the effect of phosphate and activation was seen only at low concentrations with a maximal 1.7-fold activation at mm phosphate At 121 Temperature effects on hibernator PFK allostery ... 37 °C was 7.2 The concentration of Mg.ATP was held at 0.5 mM All other assay conditions are detailed in the Materials and methods Data are means ± SEM, n ¼ separate determinations Temperature ... allosteric ligand on Vmax via the use of Arrhenius plots that graph the ratio of maximal velocities when the allosteric ligand is saturating and when the allosteric ligand is absent The plot of W vs...

Ngày tải lên: 19/02/2014, 16:20

9 579 0
Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

... or was obtained from Oriental Yeast Co (Lot 21003805) (Osaka, Japan) and proCPY was prepared as the same manner as CPY, with minor modifications Dgly CPY and Dgly proCPY, in which the asparagine ... In contrast, a DSC analysis of the mature form (CPY) revealed an apparently symmetrical single peak but the ratio of DHcal/ DHv was determined to be 1.74 (DHcal and DHv values were 765 and 440 ... and an a- helix rich domain on the right side Thermodynamic properties of CPY and proCPY Thermodynamic parameters were calculated based on Eqns (2–6) to compare qualitatively the temperature and...

Ngày tải lên: 07/03/2014, 21:20

7 439 0
Báo cáo sinh học: "Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear cell yield, viability and immunologic function" potx

Báo cáo sinh học: "Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear cell yield, viability and immunologic function" potx

... different stages of apoptosis was evaluated for CD4 and CD8 T cell populations (A) Percentage of CD4 lymphocytes in early stages of apoptosis (Annexin V+, 7AAD-) and (B) late stages of apoptosis (Annexin ... were thawed and rested overnight at 37°C before staining with CD4, CD8, Annexin V and 7-AAD The viable populations were defined as Annexin V negative and 7AAD negative and are expressed as a percentage ... support was provided by Frank and Jane Batten, the James and Rebecca Craig Foundation, George S Suddock, Richard and Sherry Sharp, and the Patients and Friends Research Fund of the University of Virginia...

Ngày tải lên: 18/06/2014, 19:20

13 606 0
Báo cáo hóa học: " Sliding and pressure evaluation on conventional and V-shaped seats of reclining wheelchairs for stroke patients with flaccid hemiplegia: a crossover trial" potx

Báo cáo hóa học: " Sliding and pressure evaluation on conventional and V-shaped seats of reclining wheelchairs for stroke patients with flaccid hemiplegia: a crossover trial" potx

... allow measurements of the sagittal motion of his or her body Four anatomical markers (bilateral acromion and greater trochanter) and four wheelchair markers on both sides of the backrest and seat ... physical therapist Geometric and mechanical parameters The geometric parameters include the degrees of sliding along the backrest (BS) and sliding along the seat (SS), which are standard measures also ... contributors to the data acquisition KCC participated in the interpretation of the data and helped to draft the manuscript All authors read and approved the final manuscript Authors’ information HCH is...

Ngày tải lên: 19/06/2014, 08:20

8 375 0
báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc

báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc

... required on a regular basis This calibration would involve setting the baseline resistance and range of the measured resistance of the sensors as determined through a series of standard repeatable exercises ... evaluations, and drafted the manuscript SB created the foam sensors, participated in the prototype pilot evaluations, and drafted the manuscript BS participated in the project organization and ... the optimal locations for sensors In addition, processing algorithms for extraction of patterns from gathered data are required, as well as wearable and wireless hardware to allow the data to be...

Ngày tải lên: 19/06/2014, 10:20

7 748 0
w