complexity of the nicotinergic system as a neurotransmitter system
Tài liệu The Value of the Case Study as a Research Strategy doc
... re-evaluation of cases Reliability is most important during the data collection phase, and involves the use of case study protocol as well as the case study database already mentioned Validity and ... that the application of the methodology is as likely (perhaps inherently) at fault as the methodology itself Qualitative research as preparation - As mentioned above, qualitative research has a ... researchers are to be able to repeat a research programme: It is for this reason that researchers like Yin are especially adamant that a case database be created and maintained to \allow repetition and...
- 15
- 587
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella ... for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae Higher ... suggests that C paradoxa PsbU has a higher homology with the red algal protein than with the cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢),...
- 11
- 501
- 0
báo cáo khoa học: "Malignant fibrous histiocytoma of the urinary bladder as a post-radiation secondary cancer: a case report" pdf
... tomography of the pelvic cavity at the levels of the neoplasm was detected at the L5 spine level, and palliative radiation therapy in that area was suggested Despite aggressive surgical treatment along ... Gross pathological examination revealed a large mass on the left lateral wall that measured 7.0 cm across its greatest dimension The surface of the tumor on the mucosal side was smooth The mass ... M, Alameda Aragoneses V, Blanco Espinosa A, Moreno Arcas P, Requena Tapia MJ: Malignant fibrohistiocytoma of the bladder [in Spanish] Actas Urol Esp 2000, 24:581-583 Froehner M, Manseck A, Haase...
- 6
- 493
- 0
Báo cáo y học: "Dermoid cyst of the urinary bladder as a differential diagnosis of bladder calculus: a case report" pps
... Misra S, Agarwal PK, Tandon RK, Wakhlu AK, Misra NC: Bladder teratoma: a case report and review of literature Indian J Cancer 1997, 34:20-21 Agrawal S, Khurana N, Mandhani A, Agrawal V, Jain ... associated with bladder diverticuli and vesical stones [5] This tumour was a solitary tumour at the apex of the bladder It contained calcified material and fat The anterior midline position of the ... and the patient as well as the Figure Sweat glands, hyalinized fibroblastic tissue Sweat glands, hyalinized fibroblastic tissue Page of (page number not for citation purposes) Journal of Medical...
- 3
- 231
- 0
Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps
... this article as: Ypsilantis and Tisi: Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case ... Goodreaau JJ, Bergan JJ: Summary of cases of adventitial cystic disease of the popliteal artery Ann Surg 1979, 189:165-175 Cassar K, Engeset J: Cystic adventitial disease: a trap for the unwary ... underwent a surgical exploration of his popliteal artery under general anaesthesia through a posterior approach that allowed adequate exposure of the popliteal artery and cysts Evacuation of all three...
- 4
- 333
- 0
Báo cáo y học: "Rapid and persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature" pot
... his last check in 2003, approximately three weeks after therapy simplification (Figure 1) Neither a preNNRTI GRT assay was available at that time, nor samples of plasma drawn in advance of the ... for a systematic evaluation of GRT in naïve patients and after any type of interruption of NNRTI-based HAART regimens, as well as the need for a wise strategy of NNRTI interruption Abbreviations ... absence of selective pressure, after administration of EFV for a year and a half In such a case, the authors postulated a possible eradication of the wild type quasispecies before HAART failure...
- 5
- 427
- 0
Báo cáo y học: " Double rupture of interventricular septum and free wall of the left ventricle, as a mechanical complication of acute myocardial infarction: a case report" pot
... whereas the anterior wall appeared hypokinetic and the apex akinetic A coronary arteriography performed on the same day showed a total occlusion of the LAD branch in its proximal part along with an ... the anteroseptal AMI was complicated by VSD near the LV apex The episode of hypotension at the fifth post-infarct day was probably the manifestation of the second cardiac rupture (FWR), which was ... apical part of contained bythat shows a( pseutinuity of the parasternalnarrowinterventricular and the right Modified left athroughcavitythe between the left septum and Modified left parasternal...
- 5
- 280
- 0
Báo cáo y học: " Network, degeneracy and bow tie. Integrating paradigms and architectures to grasp the complexity of the immune system" pps
... of architecture has been observed in the structural organization of organisms throughout the biological scale as well as in technological and dynamical systems where the management, control and ... integrated the classical mathematical framework of degeneracy with a new topobiological interpretation that knits together the structural and functional dimensions of biological organisms Page 12 of ... dynamics of the mammalian MAPK1,2 signaling network: bifan motif regulation of C-Raf and B-Raf isoforms by FGFR and MC1R FASEB J 2008, 22:1393-1403 Lipshtat A, Purushothaman S, Iyengar R, Ma’ayan...
- 16
- 255
- 0
Báo cáo y học: "Assessing the psychometric properties and the perceived usefulness of the BasisRaadsOnderzoek (BARO) as a first-line screening instrument for juvenile offenders" ppt
... Second, the concurrent validity of the instrument was calculated for the participants that underwent the global screening by means of the BARO as well as the elaborate forensic diagnostic assessment ... finally, the CPB workers evaluated the BARO as a useful and practicable instrument The BARO allows the formulation of well-founded advice Internal consistency analysis has shown that the Yindex and the ... informants The additional travelling time in particular might have increased the total duration of the assessment Further adaptations that help to increase the perceived usefulness of the instrument...
- 7
- 382
- 0
Báo cáo sinh học: "Use of the score test as a goodness-of-fit measure of the covariance structure in genetic analysis of longitudinal data" ppt
... for the environmental variance, considering the genetic covariance and the other environmental covariance parameters as nuisance parameters Let m be the vector of all these nuisance parameters The ... sub-diagonals and D is a diagonal matrix of the inverse of innovation variances Score and information matrices for D and L parameters can be calculated as functions of the rst and second derivatives of the ... statistic can also be decomposed to check the parametric assumptions on innovation variances and antedependence parameters For the genetic part of Model 10, the innovation variance was assumed quadratic,...
- 14
- 324
- 0
Implementing the balanced scorecard as a strategic management system A case of Nam Truong Son ICT corporation
... What are the goals and strategies of the company? What makes manage and measure strategy of an organization so difficult? How the company manages their business strategies? How the company leader ... a handful factors at the same time, and therefore they can not be as rational as in the classical planning approach Moreover, a strategy is a way in which managers try to simplify and order a ... must measure what is strategically important As early as 1983, Kaplan wrote about how organizations could measure organizations’ performance He argued that the missing measurements are of the non...
- 77
- 330
- 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... concentration of AT and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that the half-life of enzyme activity in the absence of heparin ... (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin ... release of heparin from the granules of mast cells which are found lining the vasculature [28,29] Thus the AT may act as a sentinel to prevent escape of active procoagulant enzymes from their...
- 10
- 668
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
- 9
- 634
- 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
... 2000 from Statistics Canada (Statistics Canada, 2002) The data and analysis related to the availability and quality of childcare for Canadian women and those from the four comparisons nations comes ... Canada and four comparison nations, 2001 Canada Overall rank Seats in parliament (%) Female legislators, senior of cials, managers (%) Female professional and technical workers (%) Ratio female:male ... disabilities—is relatively low as compared to all nations except the US The low US rate may reflect the lack of available Table Reports of being a victim of crime as percentage of total population...
- 17
- 843
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was isolated at the Albany Medical College and stored at )80 °C The skin and internal organs were harvested from female C57BL/6 mice aged weeks at telogen and anagen stages of the hair cycle as ... [29] The chemical structure of the standard had been confirmed by NMR analysis The standard was further purified by RP-HPLC and stored at )70 °C Materials and methods Enzymatic assays Biological materials...
- 11
- 475
- 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx
... kinase assays indicate that the cytoplasmic domain of the siglec protein can be phosphorylated by representatives of at least three of four major families of kinases: Jak3, Lck, Emt but not ZAP-70 ... 11783–11786 Hanasaki, K., Varki, A. , Stamenkovic, I & Bevilacqua, M.P (1994) Cytokine-induced beta-galactoside alpha-2,6-sialyltransferase in human endothelial cells mediates alpha-2,6-sialylation of adhesion ... contains several genes that may be associated with immune disease such as stem cell growth factor (SCGF), markers associated with airways hyperreactivity in asthmatics and platelet activating factor...
- 14
- 540
- 0
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the complementary ... control); lane 2, CA mutant RGA (D24 8A) ; lane 3, CA mutant AGD (R24 6A) ; lane 4, CA mutant KGA (E45 7A) ; lane 5, CA mutant AGE (K45 5A) ; lane 6, CA double mutant AGD ⁄ AGE (R24 6A ⁄ K45 5A) used as a negative ... (0–0.5 m) at a flow rate of 1.0 mLÆmin)1 The wildtype and mutated forms of recombinant cardosin A were autoactivated and assayed for activity as described by Castanheira et al [34] Binding assays In...
- 13
- 455
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25