competent packaging defective hsv 1 genome cloned as a bacteri
Báo cáo y học: "Herpes simplex 1 encephalitis presenting as a brain haemorrhage with normal cerebrospinal fluid analysis: a case report" pot
Ngày tải lên :
11/08/2014, 19:21
... PCR was positive for HSV1 DNA and negative for Enterovirus as well as for Varicella Zoster Virus A viral culture was not performed Bacterial as well as fungal cultures of the CSF were negative ... increased attenuation consistent with a small haemorrhage adjacent to the posterior body of the left lateral ventricle No abnormal enhancement was shown There was no hydrocephalus and the brain parenchyma ... arteriovenous malformations, we believe that the haemorrhage was a direct result of the HSVE The radiographic appearances were also not suggestive of a cavernoma or an arteriovenous malformation The validity...
- 4
- 216
- 0
Bài 1: Nhận biết as
Ngày tải lên :
16/09/2013, 21:10
... ( SBT): 1. 1 Vì ta nhìn thấy vật? a. Vì ta mở mắt hướng ph a vật b Vì mắt ta phát tia sáng chiếu lên vật c Vì có ánh sáng từ vật truyền vào mắt ta d Vì vật chiếu sáng Hãy vật nguồn sáng? a Ngọn ... nến cháy b Vỏ chai sáng chói trời nắng c Mặt trời d Đèn ống cháy .6 Khi ta nhận biết ánh sáng ? a Khi ta mở mắt b Khi có ánh sáng ngang qua mắt ta c Khi có ánh sáng lọt vào mắt ta d Khi đặt nguồn ... mắt ta ánh sáng Tiết 1: NHẬN BIẾT ÁNH SÁNG – NGUỒN SÁNG VÀ VẬT SÁNG I Nhận biết ánh sáng: Ta nhận biết ánh sáng có ánh sáng truyền vào mắt ta II Nhìn thấy vật: Thí nghiệm: a Đèn sáng ( H1. 2a) ...
- 8
- 389
- 1
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
Ngày tải lên :
18/02/2014, 16:20
... (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon ... Chem 275, 10 995 11 0 01 Tanaka Hall TM, Porter JA, Beachy PA & Leahy DJ (19 95) A potential catalytic site revealed by the 1. 7Angstrom crystal structure of the amino-terminal signalling domain of Sonic...
- 14
- 499
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
Ngày tải lên :
06/03/2014, 09:22
... UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5 017 [5, 12 , 38, 40] 5362–5366 5428–5437 5 418 –5437 5558–5582 ... cells Proc Natl Acad Sci USA 91, 7 311 –7 315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... ESE1 ESSp ESS2 ESE2 ESE GAR ESS3 hnRNP A1 ASF ⁄ SF2 hnRNP H hnRNP A1 SC35, SRp40 ASF ⁄ SF2, SRp40 hnRNP A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA...
- 10
- 434
- 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx
Ngày tải lên :
07/03/2014, 03:20
... Authors Journal compilation ª 2008 FEBS F Moroni and A Chiarugi PARP -1 and the ischemic neurovascular unit Astrocyte PARP -1 Neuron Inflammatory mediators AIF PARP -1 M ina am ll asa P M PARP -1 ... Luneia R & Pellicciari R (19 97) Pharmacological characterization of 1- aminoindan -1, 5dicarboxylic acid (AIDA), a potent mGluR1 antagonist J Pharmacol Exp Ther 2 81, 7 21 729 12 Pellegrini-Giampietro ... pro-inflammatory mediators is probably a result of the fact that inflammatory transcription factors such as nuclear factor-kappaB, activator protein -1 and nuclear factor of activated T-cells are positively...
- 10
- 417
- 0
moving as a child part 1 conversation
Ngày tải lên :
10/04/2014, 10:44
... was just about a teenager, so I know Kristin: Well, I, I’ve only moved once, too, when I was a child and I was eight And that was pretty tough for me Pennsylvania: a state in America Joe: Yeah, ... Moving As A Child Part Conversation Kristin: Yeah comes a point: comes a time teenager: a person between 13 and 19 years old Joe: I mean, I’ve had some friends whose parents were in the Army and ... lived there And then I moved to Pennsylvania, rural Pennsylvania I mean, it was a complete… rural: area where there is a lot of farm land Kristin: Oh gosh culture shock: feeling uncomfortable when...
- 3
- 408
- 2
moving as a child part 1 ms
Ngày tải lên :
10/04/2014, 10:44
... is an army brat What is he? An army brat, he is an army brat Is he an army brat or a plumber? An army brat, he is an army brat Who is an army brat? Is Alex an army brat? Yes, he is Alex is an army ... were uncomfortable living in a rural area and a rural area has a lot of farmland, so living in a town that had a lot of farmland made them feel uncomfortable or made them feel like it was culture ... to was rural Did the town that they moved to have a lot of farmland? Yes, it did It was rural, which is the same thing as saying it had a lot of farmland Rural means it had a lot of farmland...
- 16
- 323
- 3
moving as a child part 1 pov
Ngày tải lên :
10/04/2014, 10:44
... Moving As A Child Part POV Lesson * * * * * Okay, so that is the story as if it is happening in the past; as if it has already happened Now let’s hear the story as if it is happening in ... story happening four years from now or, say, in four years Okay, here we go * * * * * In four years Alex’ll be twelve years old He’ll be an army brat His dad will join the Army Alex and his parents ... I am twelve years old I am an army brat My dad joined the Army before I was born My parents and I lived on the moon for two years Then, out of the blue, we moved to America Right off the bat,...
- 3
- 271
- 1
moving as a child part 1 vocabulary
Ngày tải lên :
10/04/2014, 10:44
... conversation “Moving As A Child Part 1. ” If you feel that you need to, go back and listen as many times as you need to, to make sure that you understand or have a basic understanding of the vocabulary ... Now a county… This is a large area that has a city or cities within it For example: You have a city or cities and then you have a county that has the city or cities within it And then a state has ... Vocabulary Lesson Okay so getting back to the conversation… Joe is saying, “can actually be pretty traumatic to something like that as a kid.” To something such as that as a kid, or child And...
- 9
- 352
- 2
Báo cáo sinh học: " Repressor element-1 silencing transcription factor/neuronal restrictive silencer factor (REST/NRSF) can regulate HSV-1 immediate-early transcription via histone modification" pptx
Ngày tải lên :
18/06/2014, 18:20
... pFLAG-REST ICP0 cDNA 5’-TTATGTGCGCCGGAGAGACCC-3’ 5’-NNCAGCACCNCGGASAGNNNC-3’ ** * * ************ Figure HSV- 1 genome and HSV- 1 RE -1/ NRSE sequence HSV- 1 genome and HSV- 1 RE -1/ NRSE sequence A HSV- 1 ... protease inhibitor as described above Immunoprecipitation was then performed with a ChIP assay kit essentially as described by the manufacturer with an antibody against acetylated H4 (Cat#: 17 -229, ... unintentional amplification of potential genomic DNA contamination Their sequences are as follows: Actin: 5'-ATT CCT ATG TGG GCG ACG AG3' and 5'-TGG ATA GCA ACG TAC ATG GC-3'; REST/ NRSF: 5'-TGT ATT TGA...
- 11
- 215
- 0
Báo cáo sinh học: " Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" pptx
Ngày tải lên :
18/06/2014, 19:20
... an age- and gender-balanced population of 10 0 healthy adults a monocentric German study Clin Immunol 2005, 11 6 :19 2 -19 7 15 Tani S, Nagao K, Anazawa T, Kawamata H, Furuya S, Takahashi H, Iida K, ... Polymorphism Acknowledgements The ACCORD Trial was supported by grants (N 01- HC-9 517 8, N 01- HC-9 517 9, N 01- HC-9 518 0, N 01- HC-9 518 1, N 01- HC-9 518 2, N 01- HC-9 518 3, N 01- HC-9 518 4, IAA-Y1-HC-9035, and IAA-Y1-HC -10 10) ... Disease Control and Prevention; and by General Clinical Research Centers Abbott Laboratories, Amylin Pharmaceutical, AstraZeneca Pharmaceuticals LP, Bayer HealthCare LLC, Closer Healthcare, GlaxoSmithKline...
- 8
- 370
- 0
báo cáo hóa học: " Reactive oxygen species drive herpes simplex virus (HSV)-1-induced proinflammatory cytokine production by murine microglia" ppt
Ngày tải lên :
19/06/2014, 22:20
... marker Virus HSV- 1 strain 17 syn+ was propagated and titrated using plaque assay on rabbit skin fibroblasts (CCL68; American Type Culture Collection, Manassas, VA) Intracellular ROS assay Production ... 5’GCCTCTTCTCATTCCTGCTTGT-3’, antisense 5’CACTTGGTGGTTTGCTACGAC-3’ for TNF -a; sense 5’-AGACTTCCATCCAGTTGCCTTC-3’ and antisense 5’-CATTTCCACGATTTCCCAGAG-3’ for IL-6; sense 5’- AGGCTGGAGAGCTACAAGAGGA-3’ and ... Kodak Image Page of Station (Carestream Health (formerly Kodak), New Heaven, CT) Levels of phosphor-p38 (T180/Y182) and total p38 MAPK were measured using a Fast Activated Cellbased ELISA (FACE™),...
- 9
- 335
- 0
Báo cáo hóa học: " Herpes simplex virus type-1(HSV-1) oncolytic and highly fusogenic mutants carrying the NV1020 genomic deletion effectively inhibit primary and metastatic tumors in mice" pptx
Ngày tải lên :
20/06/2014, 01:20
... carcinoma Int J Oncol 2007, 30 :15 61- 1567 Page of 10 (page number not for citation purposes) Virology Journal 2008, 5:68 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Fu X, Tao L, Cai R, Prigge J, Zhang ... Experimental animals were sacrificed on day 42 post-injection of 4T1 cells and the internal organs were removed and examined for metastases formation by gross pathological evaluation as described in Materials ... broad host range make them attractive candidates as oncolytic viral agents [5-7] Furthermore, the recent availability of cloned HSV genomes into bacterial artificial chromosome vectors greatly...
- 10
- 340
- 0
báo cáo hóa học:" Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" doc
Ngày tải lên :
20/06/2014, 04:20
... an age- and gender-balanced population of 10 0 healthy adults a monocentric German study Clin Immunol 2005, 11 6 :19 2 -19 7 15 Tani S, Nagao K, Anazawa T, Kawamata H, Furuya S, Takahashi H, Iida K, ... Polymorphism Acknowledgements The ACCORD Trial was supported by grants (N 01- HC-9 517 8, N 01- HC-9 517 9, N 01- HC-9 518 0, N 01- HC-9 518 1, N 01- HC-9 518 2, N 01- HC-9 518 3, N 01- HC-9 518 4, IAA-Y1-HC-9035, and IAA-Y1-HC -10 10) ... Disease Control and Prevention; and by General Clinical Research Centers Abbott Laboratories, Amylin Pharmaceutical, AstraZeneca Pharmaceuticals LP, Bayer HealthCare LLC, Closer Healthcare, GlaxoSmithKline...
- 8
- 453
- 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt
Ngày tải lên :
20/06/2014, 15:20
... humanistic practice disease duration of disease disease * duration of disease 0.053 2.047 1. 711 3 .18 8 0.0 91 n.s 0.002 (5) nature-oriented practice SpR attitude age disease duration of disease 0.000 ... 16 5 1. 000 11 9 276 * 070 1. 000 000 450 ** 090 '15 7 1. 000 1. 000 056 1. 000 400 ** 465 ** 1. 000 - .16 7 311 ** 055 1. 000 16 6 5 81 ** 216 329 * 1. 000 1. 000 410 ** 1. 000 227 268 * 1. 000 083 313 * 16 4 1. 000 ... http://www.hqlo.com/content/3 /1/ 53 Table 2: Mean values of the items from SpREUK-P 1. 1 and reliability parameters Factors and Items P2 P20 P19 P1 P13 P14 P 11 P15 P10 P16 P7 P4 P8 P6 P5 P23 P22 P24 P25 P26 P3 P17 P18 P9...
- 11
- 425
- 0
Báo cáo toán học: " Synthesis and anti-HSV-1 evaluation of new " docx
Ngày tải lên :
20/06/2014, 20:20
... Souza TML, Giongo V, Passamani F, Magalhães UO, Albuquerque MG, Cabral LM, Rodrigues CR (2008) SAR of a series of anti -HSV- 1 acridone derivatives, and a rational acridone-based design of a new anti -HSV- 1 ... Chem Lett 21: 1675 16 77 Jordão AK, Ferreira VF, Souza TML, Faria GGS, Machado V, Abrantes JL, Souza MCBV, Cunha AC (2 011 ) Synthesis and anti -HSV- 1 activity of new 1, 2,3-triazole derivatives Bioorg ... that exhibit a broad spectrum of biological activities such as inhibitor of HIV -1 integrase [12 15 ], HCMV [16 , 17 ], FGF receptor -1 tyrosine kinase [18 ], and the enzyme acetylcholinesterase [19 ]...
- 24
- 433
- 0
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps
Ngày tải lên :
09/08/2014, 01:23
... these situations, such as that reported in Figs and 5, the importance of maintaining the local level of IL-1Ra became dramatically apparent, as were the advantages of gene transfer as a means of ... efficacy in animal models of RA and OA, and a phase I human trial has recently confirmed that the human IL-1Ra cDNA can be safely transferred to and expressed within human rheumatoid joints [19 ] A ... (Carlsbad, Ca, USA) Recombinant human IL -1 and IL-1Ra were purchased from R&D Systems (Minneapolis, MN, USA) ELISA kits for PGE2 and IL-1Ra were purchased from Dynatech (Ann Arbor, MI, USA) and...
- 9
- 421
- 0