competencies required for a sales manager

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

... constants have been reported only for AcAc-SPP [3]; for exam- ple, K m and k cat are 73 lm and 469 ⁄ s for AcAc-SPP, whereas they are 24 lm and 465 ⁄ s, respectively, for AcAc-CoA. In the crystal ... mother liquor, was allowed to continue for 4 days prior to data collection. This experiment was performed for both a wild- type thiolase crystal and a C8 9A mutant crystal. Analysis of the data collected ... stirring. After Table 3. Calorimetric analysis of CoA binding to the Z. ramigera biosynthetic thiolase at 25 °C. The values and error estimates are calculated from separate measurements (three for...

Ngày tải lên: 16/03/2014, 04:20

13 473 0
Effective Sales Management Techniques - A Few Important Steps can keep a Sales Manager Focused and His or Her Team Accountable doc

Effective Sales Management Techniques - A Few Important Steps can keep a Sales Manager Focused and His or Her Team Accountable doc

... that help is available, in fact encouraged at all times. 1 Effective Sales Management Techniques A Few Important Steps can keep a Sales Manager Focused and His or Her Team Accountable ... Philadelphia, Washington, D.C., Boston, Baltimore, Miami, San Francisco, Oakland, St. Louis, Chicago, Los Angeles and many other national and local publications. In addition, Dan has appeared ... to answer that question, the sales manager must first look at the reporting structure that he or she has put in place for the entire sales team. All sales teams should meet at least twice a...

Ngày tải lên: 30/03/2014, 12:21

6 497 1
Tài liệu Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on Alternative Investment Fund Managers and amending Directives 2004/39/EC and 2009/…/EC ppt

Tài liệu Proposal for a DIRECTIVE OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on Alternative Investment Fund Managers and amending Directives 2004/39/EC and 2009/…/EC ppt

... &apos ;manager of alternative investment funds ' or AIFM means any legal or natural person whose regular business is to manage one or several AIF; (c) 'Valuator' means any legal ... progress on activities and financial affairs, report on significant events in the financial year; (b) with regard to financial and other risks at least financial risks associated with capital structure; ... retail clients have to take into account these additional safeguards when assessing whether a certain AIF is suitable or appropriate for an individual retail client. Where a Member State allows...

Ngày tải lên: 19/02/2014, 09:20

54 756 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )123 within Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; ... Kinsella BT, O’Mahony D, Lawson JA, Pratico D & Fitzgerald GA (1994) Cellular activation of thrombox- ane receptors. Ann N Y Acad Sci 714, 270–278. 56 Yamaguchi S, Murata Y, Nagaya T, Hayashi ... )118). (6) Prm3ac; pGL3b:Prm3ac & pGL3e:Prm3ac. (Primer Kin188; 5¢-dGAGA GGTACCGAATTAATCACAAGCAA ATCTTCTC-3¢, corresponding to NTs )119 to )94). (7) Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab. (Primer Kin160;...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

... Chemicals, Darmstadt, Germany). For construction of pPC86-LPX1 and pPC97-LPX1, YOR084w was amplified using primers 5¢-CCCGGGAAT GGAACAGAACAGGTTCAAG-3¢ and 5¢-AGATCTTTA CAGTTTTTGTTTAGTCGTTTT-3¢, and ... Woolford CA, Noble JA, Garman JD, Tam MF, Innis MA & Jones EW (1993) Phenotypic analysis of protein- ase A mutants. Implications for autoactivation and the maturation pathway of the vacuolar ... (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp). Identical amino acids are indicated by an asterisk and similar amino acids are indi- cated by a colon and...

Ngày tải lên: 07/03/2014, 05:20

11 569 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc

... the transcription initiation site a TATA- like sequence (TAAATA) is located between base pairs )28 and )23. A CCAAT-consensus box is located at )86 bp (CCAAT), a reverse CCAAT motif lies at )825 ... stranded oligonucleotides spanning the region from )70 to )36 of t he xMGP promoter (5¢-GATCCAGGGGAGGGAAAACAAGGA GATGAGGAGGTGTGGT-3¢,and5¢-GATCTACCA CACCTCCTCATCTCCTTGTTTTCCCTCCCCTG-3¢) as BamHI/BglII ... constructs )180/)36TATALUC and )180/)72TATALUC were gen- erated by PCR amplification with a common, sense oligonucleotide ( 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢)...

Ngày tải lên: 08/03/2014, 10:20

10 475 0
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc

Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc

... described. HA-RPTPa R554H was obtained by site- directed mutagenesis using HA-RPTPa WT as the template and the following forward and reverse oligonucleotides: 5¢- ATG AAG AAG AAC CAT GTT TTA CAG ATC ... demonstrate here, for the first time, that a func- tional, catalytically active D2 is required for RPTPa to bind to its substrate, Src, and to dephosphorylate and activate it. Materials and methods Materials ... activation. To confirm that catalytic activity of RPTPa-D2 was required for these effects, we ana- lyzed a third mutant, RPTPa-R729K, which had an inactive D2. Again, Src binding was reduced and...

Ngày tải lên: 15/03/2014, 10:20

9 289 0
Used goods, not used bads: Profitable secondary market sales for a durable goods channel pptx

Used goods, not used bads: Profitable secondary market sales for a durable goods channel pptx

... Canan Savaskan, David Soberman, Miguel Villas-Boas, Rajiv Lal and an anonymous reviewer for helpful comments on an earlier draft. References Blair, R. D., & Lafontaine, F. (1999). Will Khan ... serve as a gateway for future empirical tests and theoretical generalizations. Acknowledgements The authors thank Fabio Caldieraro, Gregory Carpenter, Preyas Desai, Benjamin Handel, Karsten Hansen, ... 4 a ÞðÞ a 8þ 5a Þþ4q 1 a Þ hi a gaþqðÞ 3a 2q 1ÀcþgaþqðÞ 21 a qðÞ c g; a; qðÞ1 þ a À g þ a 1þgðÞ 2 2a qðÞ þ 2 a Þ2þgðÞ 6a 4q and e c g; a; qðÞ a 5À2gþ 2a agðÞþq 2À2gþ 2a agðÞ 3a 2q . For c < c, some...

Ngày tải lên: 16/03/2014, 11:20

20 332 0
Báo cáo khoa học: The b domain is required for Vps4p oligomerization into a functionally active ATPase potx

Báo cáo khoa học: The b domain is required for Vps4p oligomerization into a functionally active ATPase potx

... 5¢-AGCACGTTAATCAATTGACTACGGTTGCATTAGCGC-3¢ Vps4 Ter2 F 5¢-TTAAAAGAACCAGATTAGTCAATTGATTAACGTGCT-3¢ Vps4 Ter2 R 5¢-AGCACGTTAATCAATTGACTAATCTGGTTCTTTTAA-3¢ Vps4 RDE F 5¢-AAGCAAGAACAGTTCACTGCAGCTTTTGGTCAAGCAGGTAACTAGTCAATTGAT-3¢ Vps4 ... 5¢-GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG-3¢ Vps4 Dstr R 5¢-GGGCGGATCCTCTGCTTTTCTTTATC-3¢ Vps4 Ter1 F 5¢-GCGCTAATGCAACCGTAGTCAATTGATTAACGTGCT-3¢ Vps4 Ter1 R 5¢-AGCACGTTAATCAATTGACTACGGTTGCATTAGCGC-3¢ Vps4 ... 5¢-GACGACGAAACAAGAAAAGATGGCGCCATCGAGATG-3¢ Vps4 LTP R 5¢-CATCTCGATGGCGCCATCTTTTCTTGTTTCGTCGTC-3¢ Vps4 GAI F 5¢-TGCTCTCCAGGTGATGATATTGAAGCTGATGAATTA-3¢ Vps4 GAI R 5¢-TAATTCATCAGCTTCAATATCATCACCTGGAGAGCA-3¢ P....

Ngày tải lên: 16/03/2014, 13:20

17 313 0
Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot

Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot

... 5¢-AAGGTGCAGAAGACGCA CTT-3¢; cycE-R, 5¢-AATCACCTGCCAATCCAGAC-3¢; cdk4-F, 5¢-TACAACAGCACCGTGGACAT-3¢; cdk4-R, 5¢-TGGGCATCGAGACTATAGGG-3¢; rp49-F, 5¢-CGG ATCGATATGCTAAGCTG-3¢; and rp49-R, 5¢-GAACG CAGGCGACCGTTGGGG-3¢. Acknowledgements We ... Invitrogen for 2 h at 25 °C. DNA was visualized with DAPI. Preparations were mounted in FluoroGuard Antifade Reagent (Bio-Rad, Hercules, CA, USA), and images were obtained using an Olympus (Tokyo, Japan) ... 400) for 16 h at 4 °C, and this was followed by incuba- tion with Alexa-488-conjugated anti-rabbit IgG (1 : 400) for 2 h at 25 °C. DNA was stained with DAPI. Semiquantitative RT-PCR Total RNA was...

Ngày tải lên: 23/03/2014, 07:20

13 356 0
Selling Financial Products - A proven methodology for increasing sales of banking and financial services doc

Selling Financial Products - A proven methodology for increasing sales of banking and financial services doc

... techniques after all these years” Selling Project Finance Services – Asian bank ■ ABSA ■ Alpha Bank ■ Axa Investment Managers ■ Bank BPH SA ■ Bank of America ■ Bank of China ■ Bank of Kuwait and the ... Rabobank ■ Rand Merchant Bank (SA) ■ Rating Agency Malaysia ■ Raiffeisen International and RZB ■ Saudi Arabian Monetary Agency ■ Shell ■ Société Générale ■ Standard Chartered Group ■ State Bank ... the Middle East ■ Bank Pekao SA ■ Bank Zachodni WBK SA ■ BBVA Group ■ BNP Paribas ■ Calyon ■ Central Bank of Kuwait ■ Caixa Geral de Depositos ■ China International Capital Corporation ■ Citigroup ■...

Ngày tải lên: 23/03/2014, 11:20

8 453 1
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

... sides. A good team and a good upper management are both necessary for a manager to contribute. The hierarchy or leader of the pack Most people tend to think of a manager primarily as a leader and ... inuences and dilemmas. As a manager, you are destined to face these dilemmas on a daily basis. Managerial decision-making depends on more than just the immediate facts of the task at hand. It's ... information and keeping an adequate ow of information, so that teams don't rely on the grapevine and look towards their managers to get the information. Spokesperson A manager speaks for...

Ngày tải lên: 23/03/2014, 13:20

328 4,5K 0
Báo cáo khoa học: A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis docx

Báo cáo khoa học: A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis docx

... [8–13] and Arabidopsis thaliana [14,15]. Yeast, flies, nematodes and mammals encode a single SPO11; however, plants (e.g. Arabidopsis and rice Oryza sativa) encode at least three SPO11 paralogues ... insertional mutagenesis of Arabidopsis thaliana. Science 301, 653– 657. 43 Clough SJ & Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. ... Jasco spectropolarimeter, model J-720 (Jasco, Tokyo, Japan). Complementation of a homozygous mutant of A. thaliana spo11-1 A T-DNA insertional mutant (spo11-1-3)ofA. thaliana SPO11-1 (SALK_146172:...

Ngày tải lên: 29/03/2014, 09:20

15 393 0
Báo cáo khoa học: Mediator is required for activated transcription in a Schizosaccharomyces pombe in vitro system potx

Báo cáo khoa học: Mediator is required for activated transcription in a Schizosaccharomyces pombe in vitro system potx

... Naar, A. M., Beaurang, P .A. , Zhou, S., Abraham, S., Solomon, W. & Tjian, R. (1999) Composite co-activator ARC mediates chromatin-directed transcriptional activation. Nature 398,832. 18. Naar, ... RNAPII, Medi- ator and GTFs. Purification of the Gal4 DNA binding domain, Gal4-AP2, Gal4-VP16 and GAL4-CTF The gene that encodes the Gal4-AP2 transcriptional activator, which contains the Gal4 ... reconstituted assay using the RNAPII holoenzyme and found that Gal4-CTF is able to activate basal transcription (Fig. 5E, compare lanes 1, 2, and 3) whereas Gal4-SP1 is not (compare lanes 1, 4, and 5). Antibodies...

Ngày tải lên: 30/03/2014, 14:20

12 412 0
ENHANCING THE COMMUNICATION SKILLS OF EDUCATIONAL MANAGERS IN VINH PHUC PROVINCE: BASIS FOR A TRAINING PROGRAM

ENHANCING THE COMMUNICATION SKILLS OF EDUCATIONAL MANAGERS IN VINH PHUC PROVINCE: BASIS FOR A TRAINING PROGRAM

... in management, communication has the characteristics of management, but it retains its basic characteristics. Characteristics of communication in management have peculiarities, valuable management ... the management. To establish relationships with management objects, to deal with management tasks, to maintain management functions, management staff should have the psychological traits and ... are many ways to look) and judgment, thinking generalization, abstraction all information received. Therefore, awareness of communication is an art. There are even people concealing information...

Ngày tải lên: 13/05/2014, 15:15

125 398 0
w