comorbidities in the acute heart failure patient

... available in the prehospital setting (D-dimer, troponin, C-reactive protein) Among 248 patients, 218 met the criteria for inclusion in the study The distribution of all patients is shown in Figure ... hospital with the final diagnosis) were blinded to the results of NT-proBNP In addition, the investigators of NT-proBNP did not collaborate in making the final diagnosis On the other side, prehospital ... especially brain natriuretic peptide (BNP) and N-terminal pro-brain natriuretic peptide (NTproBNP), help in determining the cause of acute dyspnea in the prehospital setting [2,7] Point-of-care...

Ngày tải lên: 14/08/2014, 08:21

... guidelines for the diagnosis and treatment of acute and chronic heart failure: the Task Force for the diagnosis of Acute and Chronic Heart Failure of the European Society of Cardiology Eur Heart ... whereas the wet BNP level correlates with the acute congestion of the patient [32] Reaching a low BNP value at discharge, bringing the patient as close as possible to his dry BNP level, can reduce the ... current understanding suggests that in the setting of volume expansion or pressure overload, the resulting wall stress initiates synthesis of pre-pro-brain natriuretic peptide (BNP) in the ventricular...

Ngày tải lên: 13/08/2014, 20:22

... with a PAC were included in the study Treatment was directed by the clinicians in charge of the patients In 17 patients (81%), PAC was inserted within day after ICU admission After initial hemodynamic ... medians (interquartile ranges) Creatinine, norm 70 to 105 μmol/L Troponin T, norm

Ngày tải lên: 13/08/2014, 18:22

... lack of increase in LV dyssynchrony during dobutamine stress in patients with wide QRS duration (20) In contrast, Kurita et al reported on an increased mechanical dyssynchrony during pacing–induced ... optimized during exercise (24) Our findings are in good concordance with these results and underline the highly dynamic nature of mechanical ventricular dyssynchrony in heart failure patients with ... time in IDCM patients yielded the following findings: LBBB was a major determinant of the duration of LV systole, irrespective of the presence of left ventricular disease The effect of the electrical...

Ngày tải lên: 05/11/2012, 11:32

... borders of the tumor There are various sub diaphragmatic tumors including renal cell tumors and HCC which extend from below the diaphragm up to the right chambers of the heart either through the venous ... endocardium ensuring that no remnants were left behind both on the tricuspid valvular cusps and within the vicinity of the right ventricle The specimen was histopathologically investigated and ... and abdominal MRI showed no primary hepatoma or metastasis elsewhere in the body No further adjuvant therapy was considered necessary in this stage by our consulting oncologists The patient was...

Ngày tải lên: 10/08/2014, 09:22

... ventilation in infants have been performed, with nine of these trials using HFOV [12] The overall results of these trials are equivocal In a meta-analysis, Thome and Carlo [12] indicate there is ... demonstrating low mortality (31%), using a lungprotective protocol in a large heterogeneous group of acute lung injury/ARDS patients, and considering the lack of definitive data demonstrating improved ... ‘best’ method of applying conventional ventilation Competing interests JMS and SM work in the intensive care unit of the Mount Sinai Hospital in Toronto, Canada, which has received the “3100B high...

Ngày tải lên: 12/08/2014, 18:21

... shorter in other studies For instance, in a recent RCT comparing CRRT and IHD, the stay duration was only to days [14] The timeliness of initiation of renal support in the ATN Study therefore ... exclusion of these high-risk patients (see below) Patient baseline characteristics and dialysis modality allocation in the Acute Renal Failure Trial Network Study The intensive and less-intensive ... pre-existing chronic kidney disease Male patients with a baseline serum creatinine >2.0 mg/dl and female patients with a baseline serum creatinine >1.5 mg/dl were excluded from the trial The relatively...

Ngày tải lên: 13/08/2014, 11:22

... particularly in the acute setting [18] In designing the protocol, we recognized that combining continuous and intermittent modalities into a single treatment strategy would raise issues regarding the ... The percentage of days managed using IHD was calculated by dividing the number of days in the IHD phase by the total number of days of study therapy consensus in clinical practice regarding the ... the contention that the dose of intermittent therapy provided in the intensive arm was actually less than the dose of continuous therapy provided in the less-intensive arm [6] This argument is...

Ngày tải lên: 13/08/2014, 16:21

... assist clinicians in risk stratifying patients presenting with acute dyspnea regardless of the underlying disease Indeed, these biomarkers might help emergency physicians to tailor the therapy in view ... pneumonia in 32 (11%) patients, acute pulmonary embolism in (3%) patients, acute complications of malignancy in (2%) patients, hyperventilation in (2%) patients, and other causes such as interstitial ... markers) in patients presenting with acute dyspnea to the ED was suggested [33,34] These markers included natriuretic peptides, troponin, C-reactive protein, interleukin family member ST2, hemoglobin,...

Ngày tải lên: 13/08/2014, 18:22

... Jondeau G, Hasin Y, Lopez-Sendon J, Mebazaa A, Metra M: Executive summary of the guidelines on the diagnosis and treatment of acute heart failure: the Task Force on Acute Heart Failure of the European ... should we continue to use the PAC until we have further proof? For the time being there appears to be enough evidence to say that the PAC adds little to information attainable by less invasive measures ... responsiveness, and the etiology of shock, the need for routine use of the PAC in sepsis, in acute respiratory distress syndrome, and in most surgical settings has already been called into question...

Ngày tải lên: 13/08/2014, 19:20

... Jondeau G, Hasin Y, Lopez-Sendon J, Mebazaa A, Metra M: Executive summary of the guidelines on the diagnosis and treatment of acute heart failure: the Task Force on Acute Heart Failure of the European ... should we continue to use the PAC until we have further proof? For the time being there appears to be enough evidence to say that the PAC adds little to information attainable by less invasive measures ... responsiveness, and the etiology of shock, the need for routine use of the PAC in sepsis, in acute respiratory distress syndrome, and in most surgical settings has already been called into question...

Ngày tải lên: 13/08/2014, 19:20

... disease-modifying therapy Physicians must find the appropriate balance between these two models, in order to provide the most effective and individualized care for their patients Changes in the implementation ... when communicating information about a prognosis with patients and their families In order to act in the best interest of the patient, the physician should disclose prognostic information as ... explain to the patients and their families that it is in their best interest to have all the information about their condition so that they can make appropriate decisions and carry out their...

Ngày tải lên: 13/08/2014, 23:20

... Angiotensin-converting enzyme inhibitors  When the initiation of ACE inhibitor therapy leads to an increase in serum creatinine levels >30% above baseline  ACE inhibitors should be discontinued,  The ... as the drug may offer the dual benefit of reducing disease progression in both the heart and the kidney Arch Intern Med 2000 Mar 13;160(5):685-93 14 Angiotensin-converting enzyme inhibitors  In ... Disorders of the heart and kidneys whereby acute or chronic dysfunction in one organ may induce acute or chronic dysfunction of the other ACUTE CARDIO-RENAL SYNDROME (TYPE 1) Acute worsening of cardiac...

Ngày tải lên: 14/06/2015, 16:05

... associated with Survivin levels indicates the increase in risk of death for 100 fold increase in Survivin expression (Table 3) Since only these four independent variables were retained by the Cox model, ... Competing interests Gene expression levels of Survivin add significant prognostic value to the current TNM staging system of patients with gastric carcinoma The validation of these findings in larger ... qrtPCR) in the peripheral blood has been reported to correlate with patients' prognosis, the TNM staging being excluded from the final mutivariable model (forcing all variables into the Cox model)...

Ngày tải lên: 18/06/2014, 15:20

... prognostic indicator in fulminant hepatitis in patients without encephalopathy upon admission [10,11] In the present study, we examined 11 proinflammatory genes in patients receiving therapy in the ... GPIb-IX-V Therefore, upregulated VWF may represent unstable hemostasis and reflect damage to endothelial megakaryocytes expressing VWF In the signaling pathway, VWF interacts with integrins in the ... functions in the complement and coagulation cascades, linking downstream to the inflammatory process or to B cell receptor signaling NAMPT is another indicator for prognosis It is the rate-limiting...

Ngày tải lên: 18/06/2014, 16:20

... represents the rotation of the foot (external/internal rotation) in respect to the walking direction and is defined as the angle formed with the line of progression and the segment connecting the marker ... in sitting, kneeling, standing and walking is delayed compared with children with the same age These patients develop their typical gait pattern already influenced by obesity In adult life, the ... in PWS patients is likely to be the only stategy that allows them to bear their weight while extending the knee This finding is found in a lower percentage of obese subjects (35.7% – 5/14): the...

Ngày tải lên: 19/06/2014, 10:20

... for the index drug, and (c) were not initiated on olanzapine and risperidone on the same day Importantly, the inclusion of patients who were continuously treated with the index drug during the ... hospitalization following initiation on the index drug For inpatients at time of initiation on the drug, it was the first rehospitalization following discharge from the index hospitalization offset the higher ... olanzapine should be a preferred therapeutic option since patients receiving olanzapine may require less psychiatric inpatient care In addition to having economic implications, the current findings...

Ngày tải lên: 08/08/2014, 20:23

... of their hospitalisation by three independent psychiatrists-raters The first rater assessed the patients using the RPAS and the AIMS, the second using the PANSS and the EPSE and the third using ... side-effects in a sample of inpatients with schizophrenia in the acute phase of their illness Methods Subjects All patients with schizophrenia, consecutively admitted, with an acute episode of their ... population of patients with schizophrenia regarding their medication status Second, there was a lack of a specific scale measuring depression in schizophrenia Third, we studied patients in the acute...

Ngày tải lên: 08/08/2014, 21:20

... Conclusion The initial rapid differential diagnosis in a young patient displaying clinical symptoms of acute coronary syndrome progressing to acute heart failure led to diagnostic imaging procedures ... intravenous ephedrine If ephedrine infusion is ineffective, vasopressin might be used The risk of hypoglycemia is related to rebound hyperinsulinemia due to the recovery of insulin release after ... vasoactive amine thearpy was stopped Five days after surgery, the patient was transferred to the ward, where oral tolerance therapy was started He was then placed in the care of the Endocrinology...

Ngày tải lên: 09/08/2014, 01:24

... from Alkalineto patient patient to patient Some activity is located within the lining and underlying 'lobules' (a) and (b), in addition to within the connective tissue of the bursa (c) or the border ... staining for AP Note the co-distribution of AP, both the bursa-derived intrinsic enzyme and the C2C12-derived enzyme, with the BMP deposits within the tissue supporting egg maturation [27,28], the ... GCAATGATCCCAAAGTAGACCTGCCCAGACT IL-1 TNF- The sources for sequences are given in the last column, the numbers in brackets refer to the literature, and the other numbers indicate the codes from sequences in PubMed BMP,...

Ngày tải lên: 09/08/2014, 08:22