common acute lymphoblastic leukemia a model for pre b development

... childhood acute < /b> lymphoblastic < /b> leukemia < /b> Br J Haematol 1997, 97:460-462 Cayuela JM, Baruchel A,< /b> Orange C, Madani A,< /b> Auclerc MF, Daniel MT, Schaison G, Sigaux F: TEL-AML1 fusion RNA as a < /b> new target ... Satake N, Sakashita A,< /b> Kobayashi H, Maseki N, Sakurai M, Kaneko Yl: Minimal residual disease with TEL-AML1 fusion transcript in childhood acute < /b> lymphoblastic < /b> leukemia < /b> with t(12;21) Br J Haematol ... Group for < /b> Adult Acute < /b> Lymphoblastic < /b> Leukemia:< /b> Clinical significance of minimal residual disease quantification in adult patients with standard-risk acute < /b> lymphoblastic < /b> leukemia < /b> Blood 2006, 107:1116-1123...

Ngày tải lên: 10/08/2014, 22:20

... Sciences for < /b> Macintosh version 18.0 was used for < /b> all data analyses For < /b> the description of demographic variables and questionnaire scores, medium and inter quartile range (IQR), and mean and standard ... this article as: van Litsenburg et al.: Impaired sleep affects quality of life in children during maintenance treatment for < /b> acute < /b> lymphoblastic < /b> leukemia:< /b> an exploratory study Health and Quality ... Katz ER, Palmer SN, Burwinkle T, Varni JW: Parent proxy-reported health-related quality of life and fatigue in pediatric patients diagnosed with brain tumors and acute < /b> lymphoblastic < /b> leukemia...

Ngày tải lên: 20/06/2014, 15:20

... PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgttgaaacaaatggc PCR-RFLP (HaeIII) Leptin receptor gene - Q223R aaactcaacgacactctcctt tgaactgacattagaggtgac PCR-RFLP ... Michalewska D, Kolecki P, Armata J, Balwierz W, BoguslawskaJaworska J, Chybicka A,< /b> Cyklis R, Kowalczyk J, Ochocka M: Standard and intermediate risk acute < /b> lymphoblastic < /b> leukemia < /b> in Poland A < /b> report ... Children’s Leukemia/< /b> Lymphoma Study Group Acta Paediatr Jpn 1995, 37:31-36 16 Balwierz W, Moryl-Bujakowska A,< /b> Skoczeń S, Pawińska K, Balcerska A,< /b> Płoszyńska A,< /b> Chybicka A,< /b> Dobaczewski G, Juszczak K, Wachowiak...

Ngày tải lên: 10/08/2014, 10:21

... CR as the following: HA regimen as described above, DA (DNR, 30 mg/m2 daily for < /b> days, Ara-C 100 mg/m2 daily for < /b> days) or IDA (idarubicin, mg/m2 daily for < /b> days, Ara-C 100 mg/m2 daily for < /b> days), ... consolidation therapy for < /b> previously untreated adult patients with acute < /b> myeloid leukemia < /b> Blood 1992, 79:313-319 Vey N, Coso D, Bardou VJ, Stoppa AM, Braud AC, Bouabdallah R, Sainty D, Mozziconacci ... Jhanwar S, Young C, Clarkson B: Results of a < /b> randomized trial comparing idarubicin and cytosine arabinoside with daunorubicin and cytosine arabinoside in adult patients with newly diagnosed acute...

Ngày tải lên: 10/08/2014, 22:20

... minimal elevation of transaminases (alanine transaminase 74I U/L and aspartate transaminase 52I U/L) His alkaline phosphatase and g-glutamyl transferase levels were significantly raised at 293I ... 32:466-468 Daniel SV, Vani DH, Smith AM, Hill QA, Menon KV: Obstructive jaundice due to a < /b> pancreatic mass: a < /b> rare presentation of acute < /b> lymphoblastic < /b> leukaemia in an adult JOP 2010, 11:72-74 Takamatsu ... T: Preferential infiltration of liver sinusoids in acute < /b> lymphoblastic < /b> leukemia < /b> Rinsho Ketsueki 2001, 42:1181-1186 Rajesh G, Sadasivan S, Hiran KR, Nandakumar R, Balakrishnan V: Acute < /b> myeloid leukemia...

Ngày tải lên: 10/08/2014, 23:21

... myeloid leukemia,< /b> but not for < /b> lymphoblastic < /b> leukemia < /b> TMZ is a < /b> new alkylating agent; its safety profile and lack of data on any mutagenic potential has led to its incorporation in a < /b> large number of ... Curschmann J, Janzer RC, Ludwin SK, Gorlia T, Allgeier A,< /b> Lacombe D, Cairncross JG, Eisenhauer E, Mirimanoff RO, European Organisation for < /b> Research and Treatment of Cancer Brain Tumor and Radiotherapy ... Noronha V, Berliner N, Ballen KK, Lacy J, Kracher J, Baehring J, Henson JW: Treatment-related myelodysplasia/AML in a < /b> patient with a < /b> history of breast cancer and an oligodendroglioma treated with...

Ngày tải lên: 11/08/2014, 03:21

... myeloid leukemia,< /b> but not for < /b> lymphoblastic < /b> leukemia < /b> TMZ is a < /b> new alkylating agent; its safety profile and lack of data on any mutagenic potential has led to its incorporation in a < /b> large number of ... Curschmann J, Janzer RC, Ludwin SK, Gorlia T, Allgeier A,< /b> Lacombe D, Cairncross JG, Eisenhauer E, Mirimanoff RO, European Organisation for < /b> Research and Treatment of Cancer Brain Tumor and Radiotherapy ... Noronha V, Berliner N, Ballen KK, Lacy J, Kracher J, Baehring J, Henson JW: Treatment-related myelodysplasia/AML in a < /b> patient with a < /b> history of breast cancer and an oligodendroglioma treated with...

Ngày tải lên: 11/08/2014, 07:20

... Kartunnen, Lauri and Zwicky, Arnold M., Eds., Natural lanquaqe parsinq Cambridge University Press, Cambridge, England: 307-319 Robinson, Jane J 1982 DIAGRAM: A < /b> Grammar for < /b> Dialogues Communications ... - SAiPattern indicates that the v a < /b> r i a < /b> b l e $A < /b> is i n s t a < /b> n t i a < /b> t e d to the sub-tree that matches Pattern $more branches (and $1ess_branches) is a < /b> predefined preference rule that prefer ... guarantee that this will be the case for < /b> the relation as a < /b> whole or for < /b> the translation steps between intermediate levels of representation (An attempt to formalize this can be found in Krauwer...

Ngày tải lên: 22/02/2014, 10:20

... amyloid formation pathways, any sequence able to be accommodated in a < /b> b- sheet conformation can, potentially, reach the amyloid state [51,56] Amyloid-like properties of bacterial IBs Protein aggregation ... ´ E Garc a-< /b> Fruitos et al Biological role of bacterial inclusion bodies A < /b> B Fig A < /b> nucleation ⁄ polymerization selfassembly process drives the formation of IBs in bacteria (A)< /b> In vivo formation ... 2426 35 Nahalka J, Dib I & Nidetzky B (2008) Encapsulation of Trigonopsis variabilis D-amino acid oxidase and fast comparison of the operational stabilities of free and immobilized preparations...

Ngày tải lên: 06/03/2014, 00:20

... made up of transfers and relays Relays are abstract points initiating transfers and may be "covered" by a < /b> turn Landmarks can be either associated with relays or with transfers More formally, a < /b> ... A.< /b> I Technical report 540, M.I.T Artificial Intelligence Laboratory, Cambridge, MA A < /b> Yamada, T Yamamoto, H Ikeda, T Nishida, and S Doshita 1992 Reconstructing spatial image from natural language ... before the conceptual representation can be created T h a < /b> t is why we need a < /b> two-stage internal representation, based on specific linguistic and conceptual models References M Abraham and J-P Desclds...

Ngày tải lên: 08/03/2014, 07:20

... would benefit from being warned by others that a < /b> predator is near By contrast, an older female would not benefit by being informed of a < /b> predator that she had already identified Secondly, males may behave ... Australian Research Council, and was carried out under permits from the Australian National University ethics committee, the Australian Bird and Bat Banding Scheme, the Australian National Botanic Gardens ... under leaf litter, but also search under bark and in thick foliage above the ground (Keast 1978; Ambrose 1985; Cale 1994; personal observation) Adults can be sexed by plumage Female scrubwrens build...

Ngày tải lên: 14/03/2014, 16:20

... more pathogenic for < /b> humans T-even Phages        Icosahedral capsid head containing DNA Central tube surrounded by a < /b> sheath Collar Base plate Tail pins Fibers Similar stages as animal viruses ... effect is called transformation Oncoviruses- mammalian viruses capable of initiating tumors Viruses that Infect Bacteria  Bacteriophage  Most contain dsDNA  Often make the bacteria they infect ...   Ivanovski and Beijerinck showed that a < /b> disease in tobacco was caused by a < /b> virus Loeffler and Frosch discovered an animal virus that causes foot –and-mouth disease in cattle Many years of...

Ngày tải lên: 15/03/2014, 12:58

... Genomics) for < /b> running many of the analytical ultracentrifugation samples, A < /b> Padovani for < /b> making the W56F variant and J A < /b> Kornblatt for < /b> encouragement and advice Financial support was provided by the Natural ... was destabilizing G37 6A < /b> and G376E had identical Tm values At position 157, alanine had a < /b> smaller effect than aspartate, but even alanine decreased the Tm value by °C There was no correlation between ... (Stratagene, La Jolla, CA, USA) The primer sequences were as follows: 5¢-GG GGT GTT ATG GTT TCC CAT CGA TCT GAA GAA ACT GAA GAC (G376E) and 5¢-CCA TTC TTG AAC GTT TTA AAC GGT GAT TCC CAC GCT GGT...

Ngày tải lên: 16/03/2014, 06:20

... the parser has to simultaneously perform two tasks: Searching for < /b> a < /b> path to be analysed and analysing it as well If the analysis procedure is too liberal, it may already accept and analyse an ungrammatical ... the approach described 5.1 Storing Partial Analyses The first task of the robust semantic processing is to manage a < /b> possibly large number of partial analyses, each spanning a < /b> certain sub-interval ... Bianka Buschbeck-Wolf, Michael Dorna, and C J Rupp 1998 Managing information at linguistic interfaces In Proc of the 17th COLING/36 th ACL, Montrral, Canada Thomas Bub, Wolfgang Wahlster, and Alex...

Ngày tải lên: 17/03/2014, 07:20

... MejiaArangure, David Aldebarán Duarte-Rodríguez, Juan Manuel Mej a-< /b> Aranguré, Arturo Fajardo-Gutierrez, Richard McNally, Patricia Perez-Vera, Roman Crazzolara, Maria Luisa Perez-Saldivar, Angélica ... Patricia, Borgas Cesar, Zùñiga Guillermo, Puebla Ana Maria, Luis Figuera, Garcia Juan Ramon, Haitao Zhu, Dongqing Wang, Shoko Kobayashi, Ezequiel M Fuentes-Pananá, Abigail Morales-Sanchez, Juan Manuel ... C Salas-Labad a,< /b> A < /b> Reyes-León, M.P Navarrete-Meneses, E.M Fuentes-Pananá and P Pérez-Vera 191 Chapter 10 Survival of Patients with Acute < /b> Lymphoblastic < /b> Leukemia < /b> 237 Jorge Organista-Nava, Yazmín...

Ngày tải lên: 17/03/2014, 12:20

... complementary for < /b> the task and that they must be unified in a < /b> single representation A < /b> Bayesian Network Based System Grammatical−Role Left−Context−Constraints Match No−match Subject Object Preposition ... good precision (few false positive cases), but has a < /b> low recall (many false negative cases) Any sequence with a < /b> variation is ignored by the automata and it is difficult to get exhaustive adjective ... HCR−Automata Sequence−Length Start−Abstract Pronoun Start No−Start Match No−match Non−anaphoric−It Anaphoric−It Contain−Known−Adjective Contain−Known−Noun Contain No−Contain Contain−Known−Verb...

Ngày tải lên: 17/03/2014, 22:20

... demonstrating that placenta can yield higher amounts of HSCs than umbilical cord blood, and further suggesting that placenta could be banked and used for < /b> clinical transplant in a < /b> similar way to umbilical ... germ-cell malignancy Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the ... have indicated that the placenta acts as an additional extramedullary hematopoietic organ during embryonic and fetal development [52,53] Hematopoietic precursors found in the human placenta can...

Ngày tải lên: 22/03/2014, 17:20

... ®gures are drawn with MOLSCRIPT [34] and rendered by RASTER3D [35] Ê Table Buried surface areas and hydrogen bonds of the SAK dimer models Accessible surface areas are calculated with a < /b> probe radius ... 1.4 A < /b> added to the van der Waals radius Dimer model < /b> Buried surface Ê area (A2< /b> ) Hydrogen bonds Salt bridges A < /b> 77Arg A < /b> 65Glu A < /b> 65Glu A < /b> 61Glu A < /b> 58Glu None P212121 a< /b> a < /b> 1009 A < /b> 65Glu OE1 B 62Tyr OH, A < /b> ... possible dimer geometries, designated as a< /b> a,< /b> head±tail, and b b The a< /b> a < /b> dimer has a < /b> diad and is characterized as helix-helix packing between the two monomers, as shown in Fig 2A < /b> The head±tail...

Ngày tải lên: 23/03/2014, 21:21

... of Caenorhabditis elegans (AhR-1C.E.), neither photoaf®nity labeled by a < /b> dioxin analog, nor activated by b- naphto¯avone in a < /b> yeast system [20]; the rainbow trout AhRa that binds TCDD [21] and ... model,< /b> although based on low sequence similarity, is capable of explaining all known experimental and theoretical data and therefore we believe it to be accurate enough to serve as a < /b> framework for < /b> ... 13 Altschul, S.F., Madden, T.L., Scha€er, A.< /b> A., Zhang, J., Zhang, Z., È Miller, W & Lipman, D.J (1997) Gapped BLAST and PSIBLAST: a < /b> new generation of protein database search programs Nucleic Acids...

Ngày tải lên: 24/03/2014, 00:21

... intentions from natural language utterances makes the assumption that "people are rational agents who are' capable of forming and executing plans to achieve their goals" (see also Cohen and Levesque ... attainment of one goal may cause the non-attainment of another such as when a < /b> previously formed plan becomes invalid or a < /b> subgoal becomes impossible to achieve A < /b> user m a < /b> y expect to be informed of such ... Furthermore, both the definitions of better and possible alternatives are relative to a < /b> particular user In particular, if a < /b> user has several compatible goals, he should adopt the plan that will contribute...

Ngày tải lên: 24/03/2014, 02:20