commands available in a menu

Core J2ME™ Technology & MIDP phần 1 pot

Core J2ME™ Technology & MIDP phần 1 pot

Ngày tải lên : 12/08/2014, 11:20
... java.lang.Object java.lang.Runnable (interface) java.lang.Runtime java.lang.String java.lang.StringBuffer java.lang.System java.lang.Thread java.lang.Throwable Data Type Classes java.lang.Boolean ... java.io.DataInputStream java.io.DataOutput (interface) java.io.DataOutputStream java.io.InputStream java.io.InputStreamReader java.io.OutputStream java.io.OutputStreamWriter java.io.PrintStream java.io.Reader java.io.Writer ... java.lang.Byte java.lang.Character java.lang.Integer java.lang.Long java.lang.Short Collection Classes java.util.Enumeration (interface) java.util.Hashtable java.util.Stack java.util.Vector Input/output...
  • 56
  • 787
  • 1
The linux command line -  a complete introduction

The linux command line - a complete introduction

Ngày tải lên : 19/03/2014, 13:43
... Listing Installed Packages 155 Determining Whether a Package Is Installed .155 Displaying Information About an Installed Package 155 Finding Which Package Installed a File ... Installing a Package from a Package File 153 Removing a Package 154 Updating Packages from a Repository 154 Upgrading a Package from a Package File 154 Listing ... Detail 35 ARRAYS 415 What Are Arrays? 415 Creating an Array 416 Assigning Values to an Array 416 Accessing Array Elements 417 Array Operations...
  • 482
  • 2.5K
  • 0
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

Ngày tải lên : 18/06/2014, 19:20
... functioning, and disability in postwar Afghanistan JAMA 2004, 292(5):575-584 Lopes Cardozo B, Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes of Kosovar Albanians ... Internally Displaced Camps in Lira and Pader, Northern Uganda A Baseline Health Survey Preliminary Report [http://www.msf.or.jp/news/baseline/Baseline.pdf] Health and mortality survey among internally ... [http:// acqol.deakin.edu.au/index.htm] Harvard Programme for Refugee Trauma [http://www.hprtcambridge.org/Layer3.asp?page_id=32] Ichikawa M, Nakahara S, Wakai S: Cross-cultural use of the predetermined...
  • 10
  • 647
  • 0
Báo cáo hóa học: "Approaching the MIMO Capacity with a Low-Rate Feedback Channel in V-BLAST" docx

Báo cáo hóa học: "Approaching the MIMO Capacity with a Low-Rate Feedback Channel in V-BLAST" docx

Ngày tải lên : 23/06/2014, 01:20
... low-rate feedback channel, [13] introduced rate adaptation at each antenna in V-BLAST to overcome this problem We extend their approach to both rate and power adaptations at each antenna and theoretically ... ) are available per antenna In Figures and 7, the average capacity is displayed as function of the quantization levels When the power on each transmit antenna is not adapted at all (SR case), ... is generated 1000 times and the average capacity is calculated assuming that a scalar capacity-achieving code is used: Γ = at (1) First, the effect of rate quantization is investigated; later, power...
  • 10
  • 221
  • 0
Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot

Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot

Ngày tải lên : 06/08/2014, 05:20
... 15 Nguyen Xuan Thao and Nguyen Thanh Hai, Convolution for Integral Transforms and Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, On the generalized convolution ... Transform, MC Gray Hill, NewYork, 1951 19 H M Srivastava and Vu Kim Tuan, A new convolution theorem for the Stieltjes transform and its application to a class of singular equations, Arch Math ... Convolution of Hankel transform and its applications to an integral involving Bessel function of first kind, J Math and Math Sci 18 (1995) 545–550 436 Nguyen Xuan Thao and Nguyen Minh Khoa 23 D V Widder,...
  • 16
  • 336
  • 0
Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot

Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot

Ngày tải lên : 10/08/2014, 09:22
... patient also had a dextrocardia, with additionally mitral and aorta regurgitation, resulting in cardiac failure, finally leading to cardiac transplantation The third patient had a pacemaker implantation ... patients had an intact atrial and ventricular septum and an adequate subpulmonary outflow One patient had a dextrocardia and a long history of cardiac failure before transplantation The second patient ... Coronary anatomy In 13 out of the 32 patients information on coronary anatomy was explicitly available In one patient a circumflex coronary artery arose from the right coronary artery In two patients...
  • 7
  • 387
  • 0
Báo cáo y học: " Carcinoid tumor of the verumontanum (colliculus seminalis) of the prostatic urethra with a coexisting prostatic adenocarcinoma: a case report" docx

Báo cáo y học: " Carcinoid tumor of the verumontanum (colliculus seminalis) of the prostatic urethra with a coexisting prostatic adenocarcinoma: a case report" docx

Ngày tải lên : 11/08/2014, 14:21
... Immunoperoxidase staining specific for chromogranin A, neuron specific enolase, synaptophysin, pancytokeratin and PSA, and a special combined staining for racemase [a- methyl CoA] antigen and p63 antigen ... Delprado W: Carcinoid tumors of the urinary tract and prostate Arch Pathol Lab Med 2006, 130(11):1693-1706 Katayama M, Hara A, Hirose Y, Yamada Y, Kuno T, Sakata K, Morioka T, Inamine M, Shibuya ... negative for pan-cytokeratin and PSA Immunoperoxidase staining for PSA was positive in the prostatic adenocarcinoma cells, which also were positive for racemase (a- methyl CoA) antigen and negative...
  • 4
  • 226
  • 0
Báo cáo y học: "The Nordic back pain subpopulation program: Can low back pain patterns be predicted from the first consultation with a chiropractor" ppt

Báo cáo y học: "The Nordic back pain subpopulation program: Can low back pain patterns be predicted from the first consultation with a chiropractor" ppt

Ngày tải lên : 13/08/2014, 14:20
... sick-leave during 12 weeks Data analysis Agreement regarding the diagnostic classes was evaluated both as agreement regarding the main diagnostic class (level 1) and in relation to all chosen classes ... Dysfunction, postural syndrome and SI-joint pain ranked higher than facet-joint pain, abnormal nerve tension, muscle pain, and abnormal pain syndrome Agreement was only calculated as percentages since there ... chiropractors in private clinics collected baseline data using a standardized physical examination protocol for patients with LBP Based on the examination patients were sub-grouped according to a...
  • 8
  • 293
  • 0
Báo cáo khoa học: "Highly malignant soft tissue sarcoma of the extremity with a delayed diagnosis" ppsx

Báo cáo khoa học: "Highly malignant soft tissue sarcoma of the extremity with a delayed diagnosis" ppsx

Ngày tải lên : 09/08/2014, 03:22
... one case of synovial sarcoma (Figure 1) and one case of alveolar soft part sarcoma showed calcification on plain radiographs In all three cases of alveolar soft part Figure A plain radiograph ... and ankle joint (three cases), the forearm (four cases), and the popliteal area (one case) Pulmonary metastasis was detected at diagnosis in all alveolar soft part sarcoma cases and in one clear ... case was attributed to hemangioma at initial examination In alveolar soft part sarcomas, solid tumor tissues are surrounded by vascular tissues and blood flow wash-out is slow In contrast, A- V...
  • 5
  • 286
  • 0
Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

Ngày tải lên : 07/11/2012, 15:06
... cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained in ... foreign language learning, cultural topics in foreign language learning, goals for incorporating culture into the foreign language class, and Comparing and Contrasting as activities of raising students’ ... biggest headache for language teachers, especially the teacher of EFL, is how to integrate culture teaching into our language programs Comparing- Contrasting is an approach to teach language and culture...
  • 40
  • 644
  • 1
INCORPORATING ENGLISH CULTURAL ELEMENTS INTO ENGLISH TRAINING WITH THE COMPARING   CONTRASTING APPROACH a CASE OF TOURISM STUDE

INCORPORATING ENGLISH CULTURAL ELEMENTS INTO ENGLISH TRAINING WITH THE COMPARING CONTRASTING APPROACH a CASE OF TOURISM STUDE

Ngày tải lên : 07/09/2013, 13:41
... cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained in ... foreign language learning , cultural topics in foreign language learning, goals for incorporating culture into the foreign language class, and Comparing and Contrasting as activities of raising students’ ... biggest headache for language teachers, especially the teacher of EFL, is how to integrate culture teaching into our language programs Comparing- Contrasting is an approach to teach language and culture...
  • 40
  • 420
  • 0
Tài liệu Troubleshooting a NIC Using the Ping Command doc

Tài liệu Troubleshooting a NIC Using the Ping Command doc

Ngày tải lên : 21/12/2013, 19:15
... Internet Instead, the loopback is an address that pings the NIC installed in the workstation you are currently using Type the command ping 127.0.0.1 Did you receive a reply back? Are the values ... Step A workstation’s own NIC may be pinged by using its IP address, or something called the loopback address The address 127.0.0.1 is reserved as the loopback address and is not used on the Internet ... of a technician’s time will be spent troubleshooting network problems It is important that a technician try to save as much time as possible Ping is a great utility to begin troubleshooting a...
  • 3
  • 275
  • 0
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

Ngày tải lên : 16/02/2014, 11:20
... Bank and Gaza total area is 2,316 sq.mi.) Persian Gulf South China Sea Manama Malaysia Indonesia Brunei 2,227 sq.mi Malaysia Gulf of Bahrain Qatar page 45 Bandar Seri Begawan Saudi Arabia Bahrain ... Luanda Muskat Oman Angola Russian Federation Argentina Chile Atlantic Ocean Gulf of Riga Latvia Riga Lithuania Kaliningrad Oblast Belarus Poland South China Sea Rio Grande Indonesia Oecussi (Ambeno) ... territorial areas Many states are comprised of a mainland and islands, such as Australia, which consists the mainland and islands including Tasmania, Norfolk and very distant islands like Christmas and...
  • 64
  • 307
  • 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21
... Glycosaminoglycan kass (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate ... AT inhibits a large number of serine proteases of the coagulation system including thrombin (factor IIa) and factors IXa, Xa, XIa and XIIa The principal targets of the serpin are usually regarded ... Pike et al (GAGs) [3] Glycosaminoglycans such as heparin, heparan sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases,...
  • 10
  • 668
  • 0
The World with a Thousand Moons pdf

The World with a Thousand Moons pdf

Ngày tải lên : 06/03/2014, 00:20
... It was a six-legged, striped, catlike beast, not unordinary as interplanetary animals go But its head looked queer, seeming to have a bulbous gray mass attached behind its ears Captain Walls uttered ... uttered a scoffing exclamation "That's only an ordinary asteroid-cat." "That is a Vestan!" Kenniston cried "Shoot at its head—" His warning was too late The catlike beast had launched itself in a spring ... was covering the two men with a gun "We're not going in to Vesta, captain," rapped Murdock "John Dark and his pirates are on the asteroid—alive!" Captain Walls' plump face went waxy as he heard...
  • 52
  • 408
  • 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Ngày tải lên : 06/03/2014, 01:20
... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of ... was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter region is provided in...
  • 11
  • 445
  • 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt

Đề tài " The distribution of integers with a divisor in a given interval " ppt

Ngày tải lên : 06/03/2014, 08:21
... This can be interpreted as the assertion that the conditional probability that a random integer has exactly divisor in (y, 2y] given that it has at least one divisor in (y, 2y], tends to zero as ... The author also thanks G´rald Tenenbaum for several preprints of his work and for informe ing the author about the theorem of Rogers mentioned above, and thanks INTEGERS WITH A DIVISOR IN AN INTERVAL ... conversations about the paper Much of this paper was written while the author enjoyed the hospitality of the Institute of Mathematics and Informatics, Bulgarian Academy of Sciences Finally, the author...
  • 68
  • 409
  • 0
Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx

Ngày tải lên : 07/03/2014, 16:20
... 5¢-aataatccatggggagtaatacttcctggcgta aaagtgaagtcc-3¢ and 5¢-attattggatccctattgctggtccgattctgccag-3¢ 3-TPR NlpI primers (residues 62–197) were 5¢-aataatccatgg gggcacagcttttatatgagcgcggag-3¢ and 5¢-aataatggatcctcactgttc ... of water molecules ˚ Avearge B-factors (A2 ) Monomer A (main chain ⁄ side chains) Monomer B (main chain ⁄ side chains) Water molecules Ramachandaran plot (%) (most favoured ⁄ allowed ⁄ disallowed) ... SDS ⁄ PAGE against BenchMark Protein Ladder (Invitrogen), and by absorbance at 280 nm assuming a calculated emature NlpI ¼ 43 240 m)1Æcm)1 [34] Size exclusion chromatography Analytical sizing runs...
  • 14
  • 433
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20
... main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced relative to their positions in ... protein based ligands such as Lys, His and if available the N-terminal a- amino group competing for the vacant coordination site [11,31,38–40] Owing to the paramagnetic properties of a low-spin ... being minimal the trapping of two main-chain conformations and increased B-factors at 295 K suggests that the presence of the coordinating Lys in some way can in uence the dynamics of the ligand...
  • 15
  • 509
  • 0