combined rotation and translation of a rigid body

Báo cáo hóa học: " Research Article Implementation and Validation of a New Combined Model for Outdoor to Indoor Radio Coverage Predictions" pptx

Báo cáo hóa học: " Research Article Implementation and Validation of a New Combined Model for Outdoor to Indoor Radio Coverage Predictions" pptx

Ngày tải lên : 21/06/2014, 11:20
... buildings, and a laser meter to measure the height of each building Hence it is not a real full 3D database but a 2.5D database, in a dat format similar to the one used by commercial RO software After ... second component of the combined approach of this paper 2.3 Comparison RO models and FD models are very different and both of them have advantages and drawbacks Comparisons between them have been developed ... Tracing and Ray Launching where: (i) ray Launching emits the rays from the transmitter Signal strength degenerates as the rays propagate and additional loss is added when rays reflect or diffract...
  • 9
  • 439
  • 0
Báo cáo y học: "The feasibility of axial and coronal combined imaging using multi-detector row computed tomography for the diagnosis and treatment of a primary spontaneous pneumothora" pps

Báo cáo y học: "The feasibility of axial and coronal combined imaging using multi-detector row computed tomography for the diagnosis and treatment of a primary spontaneous pneumothora" pps

Ngày tải lên : 10/08/2014, 09:21
... cranio-caudal evaluation is necessary for accurate examination of ELCs HRCT is traditionally performed by axial imaging Although axial imaging has the advantage of the central and peripheral areas ... suspected area was resected The final confirmation of ELCs was based on the pathology reports Axial and coronal HRCT protocol Data analysis The imaging parameters were as follows: 1.0 mm collimation, ... extent of the resection The combined axial-coronal view was a more effective clinical tool for preoperative diagnosis and surgical planning than simple axial HRCT for the diagnosis and treatment of...
  • 5
  • 657
  • 0
báo cáo khoa học: "Long-term follow-up after en bloc resection and reconstruction of a solitary paraganglioma metastasis in the first lumbar vertebral body: a case report" ppt

báo cáo khoa học: "Long-term follow-up after en bloc resection and reconstruction of a solitary paraganglioma metastasis in the first lumbar vertebral body: a case report" ppt

Ngày tải lên : 11/08/2014, 00:22
... retroperitoneal paragangliomas: natural history and response to treatment Surgery 1990, 108:1124-1129 Singh NG, Sarkar C, Sharma MC, Garg A, Gaikwad SB, Kale SS, Mehta VS: Paraganglioma of cauda equina: ... demonstrated a thinly encapsulated neoplasm The diagnosis of a paraganglioma was confirmed by histologic and immunohistologic examinations Because vascular invasion and focal infiltration of the ... of seven cases Brain Tumor Pathol 2005, 22:15-20 Fries JG, Chamberlin JA: Extra adrenal phaeochromocytoma Surgery 2009, 13:268-279 Lack EE: Extra-adrenal paragangliomas Pathology of Adrenal and...
  • 6
  • 323
  • 0
báo cáo khoa học:" Endoscopically assisted procedure for removal of a foreign body from the maxillary sinus and contemporary endodontic surgical treatment of the tooth" ppt

báo cáo khoa học:" Endoscopically assisted procedure for removal of a foreign body from the maxillary sinus and contemporary endodontic surgical treatment of the tooth" ppt

Ngày tải lên : 11/08/2014, 23:22
... clear mucus toward the natural ostium It is possible that the foreign body dislocated near the maxillary natural ostium created an antral inflammation of the overlying mucosa and a disturbance ... infraorbital region and nasal stuffiness In this case a small bone window in the lateral wall of the maxillary sinus was performed in order to obtain a contemporary endodontic surgical treatment ... roots body located in molar Computed tomography scan (coronal plane) showing the foreign body located in the supero medial aspect of the maxillary sinus and partial mucosal thickening of the...
  • 5
  • 420
  • 0
Báo cáo y học: " Coordinate enhancement of transgene transcription and translation in a lentiviral vector" pps

Báo cáo y học: " Coordinate enhancement of transgene transcription and translation in a lentiviral vector" pps

Ngày tải lên : 13/08/2014, 09:21
... (5'TTTTTATCGATAAGCTCAATATTGGCCATATTATTCAT TGG3' and 5'TTTTCATATGCAGTTGTTACGACATTTTGGAAAG3') and ligated with NdeI-ClaI-digested PCE-Luc and U3-Luc in order to create IE-PCE-Luc and IE-U3-Luc, respectively Transient ... and participated in the data analysis and preparation of the manuscript SF participated in the design of the study and carried out the statistical analysis MDL participated in the preparation of ... of the manuscript KBL coordinated the design and implementation of the study, the data analysis, and the preparation of the manuscript All authors read and approved the final manuscript Acknowledgements...
  • 10
  • 325
  • 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

Ngày tải lên : 12/09/2012, 15:05
... have been primarily in the areas of cost and capacity rather than performance There are two components of disk performance: transfer bandwidth and access time Although both of these factors are ... simulates the actions of a cleaner until a threshold number of clean segments is available again In each run the simulator was allowed to run until the write cost stabilized and all coldstart variance ... separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database system can...
  • 15
  • 1.4K
  • 0
Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"

Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"

Ngày tải lên : 25/10/2012, 11:48
... Clinically significant oroantral communications a study of incidence and site Int J Oral Maxillofac Surg 1994;23:19-21 Haas R, Watzak G, Baron M, Tepper G, Mailath G, Watzek G A preliminary study of ... and clavulanic acid g The fixed partial prosthesis was removed and the contiguous mucosa appeared healthy A buccal full thickness flap was harvested and the presence of a small OAF was verified ... characteristics of OAC/OAF; the apexes of tooth 26 were in extremely close approximation to the maxillary sinus, and an area of periapical rarefaction was evident (Fig 1) After the failure of the endodontic...
  • 5
  • 573
  • 0
Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester

Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester

Ngày tải lên : 05/09/2013, 16:11
... degrees, the peak rate of heat release is at 357 degree crank angle and on retarding by and degrees, the peak heat release rate is found at 362 and 363 degrees against 361 degree with standard timing ... development of biofuel, Planning commission, Government of India, 2003 S Jindal, B.P Nandwana, N.S Rathore Comparative evaluation of combustion, performance and emissions of Jatropha methyl ester and Karanj ... hydrocarbon (HC) and oxides of nitrogen (NOx) with exhaust gas opacity The software enables evaluation of performance from the acquired data using standard relationships The BTHE is evaluated...
  • 10
  • 828
  • 1
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Ngày tải lên : 05/09/2013, 16:30
... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets of ... Nelder and Mead A global analysis of Tables and reveals an important outcome: the method of Powell systematically leads to the smallest values of the objective function and of the number of simulator ... Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with use of...
  • 14
  • 593
  • 0
the meaning and structure of a narrative a systemic functional analysis

the meaning and structure of a narrative a systemic functional analysis

Ngày tải lên : 07/09/2013, 13:48
... the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... explore the meaning and structure of Torquay? But I said Turkey! as a text The analysis is based on the framework of Hallidays (1994)An Introduction to Functional Grammar, Halliday and 21 Hasans (1997) ... Japanese embassy Mode: Mood: declarative Modality: ability of the main character on the past - Medium written channel - High lexical density and parataxis and low grammatical intricacy CHAPTER IV:...
  • 39
  • 826
  • 2
Design and Implementation of a Three-Phase Induction Motor Control Scheme

Design and Implementation of a Three-Phase Induction Motor Control Scheme

Ngày tải lên : 27/10/2013, 23:15
... advantages are clearly explained Wildi also presents the two types of induction motors: “the squirrel cage induction motor” and the “wound motor” An explanation of the advantages and disadvantages ... Therefore, data acquisition, debugging and fault logging are realized • × fast A/ D (Analogue to Digital) converters with 10-bit resolution make the computation of accurate, real-time phase current measurements ... to generate a means of instantaneously controlling the torque and flux Field-orientated controllers require control of both magnitude and phase of the AC quantities and are, therefore, also referred...
  • 93
  • 693
  • 1
Design and Simulation of A CMOS-MEMS Accelerometer

Design and Simulation of A CMOS-MEMS Accelerometer

Ngày tải lên : 27/10/2013, 23:15
... on a probe station Table lists major parameters of the device Only the ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a ... total sensing capacitance of 60fF Parasitic capacitance and mismatch of sensing capacitance is measured in a way as shown in Figure 5.4 The capacitance ratios are derived from the ratios of driving ... capacitors, Cd is about an order of magnitude larger than Cd_air, so approximately the total gap capacitance is equal to the sum of Cm_air and Cd_air, which is close to the gap capacitance of...
  • 40
  • 588
  • 1
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx

Ngày tải lên : 21/12/2013, 19:15
... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...
  • 2
  • 392
  • 0
Tài liệu Design And Simulation Of A Cmos-Mems Accelerometer doc

Tài liệu Design And Simulation Of A Cmos-Mems Accelerometer doc

Ngày tải lên : 22/12/2013, 08:16
... on a probe station Table lists major parameters of the device Only the ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a ... total sensing capacitance of 60fF Parasitic capacitance and mismatch of sensing capacitance is measured in a way as shown in Figure 5.4 The capacitance ratios are derived from the ratios of driving ... capacitors, Cd is about an order of magnitude larger than Cd_air, so approximately the total gap capacitance is equal to the sum of Cm_air and Cd_air, which is close to the gap capacitance of...
  • 40
  • 580
  • 0
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source

Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source

Ngày tải lên : 22/12/2013, 08:58
... analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, first beam results, and ... solutions and precision measurements Nucl Instr Meth Phys Res A2 98: 13–21 Bhawalkar D D, Bhujle A G, Fatnani P, Hannurkar P R, Joshi S C, Karmarkar M G, Kotaiah S, Mhaskar S P, Pande S A, Prabhu S ... development at CEA/Saclay Rev Sci Instrum 75(5): 1414–1416 http://laacg1.lanl.gov Poisson code, Reference manual, LA-UR-87-126, LANL 1987 Jain S K, Jain A, Sharma D, Hannurkar P R 2006 Acquisition and analysis...
  • 8
  • 650
  • 0
Tài liệu Controlling the Playback Speed and Direction of a Timeline docx

Tài liệu Controlling the Playback Speed and Direction of a Timeline docx

Ngày tải lên : 24/12/2013, 07:17
... that the user can employ to navigate this timeline forward and backward Return to the main timeline With the Actions panel open, select Frame of the Actions layer and add the following script at ... the statement is executed, the function has been passed a value of "ff" or "rew" This part of the conditional statement has a nested if/else statement Because the task of fast-forwarding and rewinding ... lines of script within the else part of the statement handle this common functionality in either case Following that, the value of action is further evaluated If action has a value of "ff", an onEnterFrame...
  • 9
  • 355
  • 0
Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Ngày tải lên : 15/01/2014, 15:59
... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... between Chicago and Amsterdam TCP Throughput (Mbps) 80 70 60 50 40 30 20 Number of UDT flows 10 Stability • Stability index of UDT and TCP – Stability: average standard deviation of throughout ... TCP flows and UDT flows between SARA and StarLight Realtime snapshot of the throughput The UDT flows have similar performance and leave enough space for TCP flows TCP Friendliness • Impact on short...
  • 32
  • 580
  • 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc

Ngày tải lên : 18/01/2014, 04:20
... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...
  • 2
  • 374
  • 0
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Ngày tải lên : 12/02/2014, 20:20
... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg ... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material...
  • 18
  • 712
  • 4