collection storage and genomic dna extraction

... and c¢¢), spermidine (lanes d, d¢ and d¢¢) or putrescine (lanes e, e¢ and e¢¢) and then exposed to DNase I Whole genomic DNA (lane a) and DNase I-digested genomic DNA (lane b) were controls (B) ... whole genomic DNA (lane a) and the DNA fully digested by DNase I (lane b) The DNA kb ladder marker was in lane m Fig Electrophoresis of genomic DNA preincubated with single polyamines and then ... of genomic DNA preincubated with 600 lM spermine (lane c), spermidine (lane d) or putrescine (lane e) and exposed to DNase I Controls were in lanes a (whole genomic DNA) and b (DNA exposed to DNase...

Ngày tải lên: 23/03/2014, 15:20

... aspects of the study, collection of clinical samples, culture of C trachomatis and performed DNA extraction, PCR analysis and drafted the manuscript IB and SM performed parts of DNA extraction as well ... the different DNA extraction methods detection Chlamydia trachomatis EB and C trachomatis PBMO DNA/ ml SF using PCR-system for amplification immediately after extraction and post storage at -20°C ... EB DNA in combination with all DNA extraction methods applied None of the other amplification systems allowed higher sensitivity than PCR regardless of the extraction method employed The DNA extraction...

Ngày tải lên: 12/08/2014, 11:22

... word clustering and help with the interpretation of statistical results, GB and AMA retrieve and organize the genome and methylation databases, and JLO developed the algorithm and wrote the manuscript ... islands) using three different distance models: cpgISg (genome intersection), cpg50 (median) and cpgISc (chromosome intersection) The overlap with two gene regions (TSS and R13), Alu elements and ... have been measured and both absolute numbers and percentages are given might be biologically meaningful, we compared the percentage of methylated words (CAG and CTG) inside and outside of the...

Ngày tải lên: 12/08/2014, 17:20

... nhanh (cache, nhớ chính) xem lưu trữ sơ cấp (primary storage) , thiết bị lưu trữ mức thấp đĩa từ xem lưu trữ thứ cấp hay lưu trữ trực tuyến (on-line storage) , thiết bị lưu trữ mức thấp gần thấp đĩa ... lên đĩa lần, không cho phép xoá viết lại, đĩa viết lại (rewritable) v v • Lưu trữ băng từ (tape storage) : Lưu trữ băng từ thường dùng để backup liệu Băng từ rẻ đĩa, truy xuất liệu chậm (vì phải ... Lưu trữ đĩa tồn cấp nguồn Lưu trữ đĩa bị hỏng hóc, không thường xuyên • Lưu trữ quang (Optical storage) : Dạng quen thuộc đĩa quang học loại đĩa CD-ROM : Compact-Disk Read-Only Memory Dữ liệu...

Ngày tải lên: 15/09/2012, 09:38

... specify the storage mode and aggregation design The next section introduces the steps involved in using the Storage Design Wizard to design storage modes and aggregations: ! Choosing a storage mode ... Managing Storage and Optimization Exercise Modifying the Storage of the Sales Cube In this exercise, you will update the storage design for the Sales cube You will apply the ROLAP storage mode and ... specify storage type In the Module 08 database, right-click the Sales cube and click Design Storage Click Next to skip the welcome page From the Select the type of data storage step, click MOLAP, and...

Ngày tải lên: 18/01/2014, 05:20

... conformations on DNA methylation In this work, the effect of the intercalated [9] (+)-cis-antiB[a]P-N2-dG adduct on the DNA binding and catalytic activity of SssI and HhaI was examined and compared ... residues in the DNA duplexes, and are consistent with a base-flipping model of the dC target residue Binding and methylation studies The interactions of M.HhaI and M.SssI with DNA containing site-specifically ... intercalated into the DNA A Fig Bar graphs representing relative Kd (K rel ) and kcat (k rel ) values for binding and d cat methylation of DNA containing (+)-cis-B[a]PN2-dG and (+)-trans-B[a]P-N2-dG...

Ngày tải lên: 19/02/2014, 00:20

... Therefore, systemic and extensive investigations are still required to assign universally appropriate parameter sets of the temperature-dependent thermodynamics for the DNA/ DNA and RNA /DNA oligonucleotide ... the present study, we determined the temperatureindependent and temperature-dependent thermodynamic parameters of 24 DNA/ DNA and 41 RNA /DNA oligonucleotide duplexes The heat capacity changes were ... AND METHODS Material preparations DNA and RNA oligonucleotides were synthesized on a solid support using the standard phosphoramidite method with an Applied Biosystems Model 391 synthesizer and...

Ngày tải lên: 22/02/2014, 07:20

... )74G and )76G (bottom strand) and )33G, )35G, )46G, )56G and )68G (top strand) (Fig 3B) All the protected guanine bases except )56G are located in and around O1 and O2 Interestingly, )35G, )41G and ... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig 2A) was synthesized ... performed a DNase I footprinting experiment using 200 nm CI and radioactively labeled O DNA (Fig 2B) The footprints of both the top and bottom strands of O DNA reveal that two regions in O DNA became...

Ngày tải lên: 07/03/2014, 00:20

... [32P]ATP[cP] and polynucleotide kinase DNA polymerase assays A standard reaction (15 lL) contained lm each of the primer and template and mm each of deoxynucleoside triphosphate, DNA polymerase and the ... of DNA repeat sequences DDI-1A and DDI-1B on AAT, CAG and CA repeats are relatively better than for ATT, CTG and GT the labeled primer and the template expansion system implied that template and ... right-handed, hence in the P conformation [14] In order to observe the conformational transitions of DNA directly and to eliminate drug interference, the CD spectra of native DNA and altered DNA, ...

Ngày tải lên: 07/03/2014, 06:20

... of unlexicalized, open extraction in O- CRF and lexicalized, supervised extraction in R1- CRF improves precision and F-measure compared to a standalone RE system 5.1 Open Extraction This section ... relations, and manually labelled positive and negative instances by hand over all collections For each of the four relations in our collection, we trained R1- CRF from labeled training data, and ran ... estimation for information extraction In Procs of HLT/NAACL A Culotta, A McCallum, and J Betz 2006 Integrating probabilistic extraction models and data mining to discover relations and patterns in text...

Ngày tải lên: 08/03/2014, 01:20

... standard Sentences should first be selected as the testing collection, and then the corresponding gold standard can be generated Our aim is to generate testing collections and their gold standards ... the annotator and the gold standard The methodologies are introduced in the next section Testing Collections and Gold Standards The gold standard of relevance, the opinionated issue, and the opinion ... themselves, the strict and the lenient testing collections and their corresponding gold standard are generated Considering the Kappa values of each annotator and the gold standard, topics with high...

Ngày tải lên: 08/03/2014, 02:21

... solvents and extraction time–temperature Several extractant mixtures and extraction techniques including mechanical shaking, microwave-assisted extraction (MAE) or sonication for arsenic extraction ... ± 0.03 ␮g g−1 As) and DORM-2 (18.0 ± 1.1 ␮g g−1 As) Results and discussion 4.1 Extraction efficiency of total arsenic for chicken, rice, fish and soil In order to increase the extraction efficiency ... in rice and chicken is of the same order of magnitude and about three and two orders of magnitude lower than that of soil and fish, respectively The 9:1 methanol:water mixture for arsenic extraction...

Ngày tải lên: 15/03/2014, 23:49

... poly (dT) Lanes and 2, control reaction with DNA polymerase a-primase lacking TAg or vice versa; lanes and 4, 0.2 U and 0.4 U of human; lanes and 6, 0.2 U and 0.4 U of murine DNA polymerase a-primase ... support DNA replication of a plasmid carrying the JCV origin Columns and 3, SV40 Tag with human and murine DNA polymerase a-primase, respectively; columns and 5, JCV Tag with human and murine DNA ... with BSA as a standard (Biorad, Munich) DNA polymerase a and DNA primase assays were performed as previously described [34,42,43] Preparation of S100 extracts and replication of SV40 and JCV in vitro...

Ngày tải lên: 17/03/2014, 03:20

... metallothionein L Villarreal et al Fig Structure and synteny of the chicken, mouse and human genomic regions containing the MT genes The chromosome number and bands enclosing the MT cluster are indicated ... induced substitutions Bacterial strains and plasmids The Escherichia coli strains DH5a [32] and JM105 [33] were used for DNA manipulation and sequencing, and BL21 was used [34] for recombinant ... lm, 300 lm and 500 lm, respectively Cloning of the chicken MT cDNA and its separate a and b domains for recombinant expression The ckMT coding sequence, kindly provided by Dr G.K Andrews of the...

Ngày tải lên: 30/03/2014, 11:20

... preference and amino acid usage are calculated for genes in each isochore and chromosome Table lists the results for the NOR and the mitochondrial DNA insertion isochore in chromosome II and the ... composed of several GC-rich and AT-rich regions alternatively The identified isochores, centromeric regions and NOR in chromosome II and IV are indicated with black lines, red and orange dots, respectively ... NORs juxtapose the telomeres of chromosomes II and IV, which comprise uninterrupted 18 s, 5.8 s, 25 s RNA and s RNA genes, and they form the structural and catalytic cores of cytoplasmic ribosomes...

Ngày tải lên: 30/03/2014, 20:20

... Managing file screening and storage reporting 767 Understanding file screening and storage reporting Managing file screening and storage reporting ... disks and storage 477 Chapter 14 TPM and BitLocker Drive Encryption 533 Chapter 15 File system essentials 581 Chapter 16 Maintaining and optimizing storage ... Essential storage technologies Using internal and external storage devices Storage- management features and tools...

Ngày tải lên: 05/04/2014, 15:31

... effects and in some case even grand-maternal effects (88–92) The Taming of TEs and Their Technical Applications At present a deep and detailed understanding of the complex biology of mobile DNAs and ... between TEs and heterochromatin is still controversial In general, TEs and their derivatives are found as highly enriched clusters in genomic regions close to the centromere and telomere, and along ... 1970s and early 1980s, mobile DNAs were classified as “selfish DNAs” or “ultimate parasites” (16,17) The authors of both classic papers pointed out that the presence and spread of mobile DNAs...

Ngày tải lên: 11/04/2014, 09:51

... that uses the DNA as a template We observed that the NH2-functionalized polymer film was useful for aligning and immobilizing the DNA, and thus the DNA- templated nanowires Keywords: DNA molecules; ... phosphate groups in the DNA The observation by AFM showed that the DNAs stretched on the NH2-functionalized polymer films and that the AuNPs were assembled along DNA molecules Results and discussions ... aligned DNA molecules was 0.41 ± 0.17 nm (Figure 3b), and this value was consistent with the height of a double-stranded DNA from the AFM measurements that were reported by other groups [10, 11] λ-DNAs...

Ngày tải lên: 20/06/2014, 23:20

... digital form for further handling and storage, also the data communication with an external motion estimation core should be digital This enables high-speed I/O operations and makes a separate analog ... supported by the Academy of Finland projects 107645 and 123354 References [1] L O Chua and L Yang, “Cellular neural networks: theory,” IEEE transactions on Circuits and Systems, vol 35, no 10, pp ... implemented with switches and logic inside the cell Because neighborhood connections to the 2nd and 5th neighbors are only available in the cardinal directions (N, E, S, and W), the shifts to the...

Ngày tải lên: 21/06/2014, 22:20

... 50, 100 and 150 mg/kg body weight doses of nano-anatase TiO2, the positive bands at 220 and 272 nm increased and red shifted by 2–3 nm, and the negative bands at 210 and 244 nm decreased and red ... weight doses of nano-anatase TiO2, the positive bands at 220 and 272 nm increased and red shifted, and the negative bands at 210 and 244 nm decreased and red shifted, indicating that the 113 transformation ... catalyzed DNA damage in both in vitro and human cells They also used nano-TiO2 samples extracted from sunscreens to attack PBII DNA under the ultraviolet light between 300 and 400 nm, and relaxed standards...

Ngày tải lên: 22/06/2014, 00:20