... that not having daily rounds by an ICU physician was associated with a threefold increase in in-hospital mortality as well as an increased risk of cardiac arrest, acute renal failure, septicaemia, ... informed about the patients’ special problems, and overworked Occasionally, they are even unavailable when needed, because they have to deal with other tasks, such as anaesthesia Certainly, a well-organised ... information and communication as possible, an adequate, 24 -hour covering consultant service of various specialities, 24 -hour availability of diagnostic services and therapeutic interventions, and...
Ngày tải lên: 12/08/2014, 18:20
... in all its actuality, I must choose an individual case for examination I can only deal with one case, and that case cannot be the average case, because there is no such case as the average case, ... fully and comfortably within the narrow limits of twenty four hours a day, let us avoid at any cost the risk of an early failure I will not agree that, in this business at any rate, a glorious failure ... Live on Twenty Four Hours a Day How to Live on Twenty Four Hours a Day had never wasted or misapplied a single moment in all your career Which fact is very gratifying and reassuring You can turn...
Ngày tải lên: 07/08/2014, 19:22
How to Live on Twenty−Four Hours a Day phần 2 ppsx
... ill−advised that something may have been To something else means a change of habits And habits are the very dickens to change! Further, any change, even a change for the better, is always accompanied ... final suggestion to make That is, as regards the evenings, to allow much more than an hour and a half in which to the work of an hour and a half Remember the chance of accidents Remember human ... scales on the piano Having acquired power over that most unruly member of one's complex How to Live on Twenty Four Hours a Day 12 How to Live on Twenty Four Hours a Day organism, one has naturally...
Ngày tải lên: 07/08/2014, 19:22
Tài liệu A.2. Four Kinds of Installation doc
... Install" option.) A clean installation provides a healthier, more glitch-proof copy of 10.5 See "The Clean Install" on Section A. 6 MacOSX10.5 In times of dire troubleshooting, when nothing in Appendix ... when nothing in Appendix B has helped, you can actually give yourself a fresh copy of 10.5, even though it's already on the hard drive See "The Clean Install" on Section A. 6 ...
Ngày tải lên: 14/12/2013, 12:15
Tài liệu Tiếng Anh lớp 1, 2 - Lesson twenty- four (Bài 24) ReVISION (Ôn tập) docx
... - Are you Mai? - No, I am not - What is your name? - My name is Lan - What is your job? - I am a pupil - Where is your school? - It is on Tran Phu Street - Is it big? - Yes, it is big and beautiful ... Easy - Fine - Waiter - Actress - Điền vào chỗ trống câu (Dùng từ: Some, any, half, a quarter, at home, at the office, at the school, in the morning, at noon, in the afternoon, ... beside my school - Are there many rooms in it? - Yes, there are - Are you happy at home and at the school? - Yes, I am - Good bye! - Good bye! Dịch sang tiếng Anh đoạn hội thoại sau: - Chào bạn!...
Ngày tải lên: 26/01/2014, 13:20
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... which are not asked, and also contain practical examples Human-powered answers often contain unrelated information and discourselike elements Additionally, the answers not always have a connection ... $0.01 Amazon.com collects a 10% (or a minimum of $0.05) service fee per each paid reward • Qualifications To improve the data quality, a HIT can also be attached to certain tests, “qualifications” ... substantial In the field of automatic summarisation, the overlap of the automatic results and corresponding manual summarisations is generally much lower than the overlap between our answers (Chali...
Ngày tải lên: 20/02/2014, 09:20
Báo cáo khoa học: A novel four transmembrane spanning protein, CLP24 A hypoxically regulated cell junction protein pdf
... gaggctgccctgcgctccgctttgctttgggattaatttattctgcatct gctgagaggggcaccccagccatatcttacactttggtaaagcagaaaac caggaaaattttcttaaaatatccacaatattccttgagtgagtcagaat ctatagccggttagtgatggtttcaggcagaatcgtgttcgtgtctgttt tgctcgattcctttcctaagttaaataaatgcaagcctctgaacttctgt ... aaaaaacaaccatttcctctctgctgagagccagggaaggcgagctctgc gcacacgggcgtccctgcagcagccactctgctttccaggaccggccaac tgccctggaggcatccacacaggggcccaggcagcacagaggagctgtga acccgctccacaccggccaccctgcccggagcctggcactcacagcaggc ... GCGCGCTTTCGCCGTGGGCTGGACAATGACTACGTGGAGTCACCATGCTG A R F R R G L D N D Y V E S P C * Agtcgcccttctcagcgttccatcgatgcacacctgctatcgtggaacag cctagaaaccaagggactccaccaccaagtcacttcccctgctcgtgcag aggcacgggatgagtctgggtgacctctgcgccatgcgtgcgagacacgt...
Ngày tải lên: 30/03/2014, 14:20
Báo cáo y học: "Reducing mortality in severe sepsis with the implementation of a core 6-hour bundle: results from the Portuguese community-acquired sepsis study (SACiUCI study)" pps
... Sebastião, Santa Maria da Feira); Paula Castelões (Unidade de Cuidados Intensivos, Centro Hospitalar de Vila Nova de Gaia); Teresa Cardoso (Unidade de Cuidados Intensivos Polivalente, Hospital ... authors have made substantial contribution on the conception, design and acquisition of data and/or analysis and interpretation of data, as well as in the drafting, revising and final approval of ... Garg R, Levy H, Talwar D, Trzaskoma BL, François B, Guy JS, Bruckmann M, Rea-Neto A, Rossaint R, Perrotin D, Sablotzki A, Arkins N, Utterback BG, Macias WL: Drotrecogin Alfa (Activated) for Cardoso...
Ngày tải lên: 13/08/2014, 20:22
36480 twenty four seven love
... If you want me to you right You're gonna have to love me day and night 24/7 love you know, just what I need It's what I need If you want me to you right You're gonna have to love me day and night ... minute, hour I'll be waiting for you Come put your lovin' on the line Take me in your arms and let me know that it's all right Look into my eyes and let me see you deep inside 24 hours a day, seven ... 24/7 love you know, just what I need It's what I need In the morning, in the evening In the Winter, Spring or Summer Whether it's early or it's late It doesn't matter any time Tender loving sweet...
Ngày tải lên: 28/08/2016, 10:10
four hour work week
... surfadventure company based in the tropical paradise of Florianopolis, Brazil He had met his dream girl, a Carioca with caramel-colored skin named Tatiana, and spent most of his time relaxing under palm trees ... psychological baggage None of my disasters came to pass, and my life has been a near fairy tale since The business did better than ever, and I practically forgot about it as it financed my travels around ... already lived 20 years of partial retirement in perfect health Don't save it all for the end There is every reason not to -Q &A: QUESTIONS AND ACTIONS I am an old man and have known a great many...
Ngày tải lên: 30/10/2016, 18:39
PRACTICAL TAXIDERMY A MANUAL OF INSTRUCTION TO THE AMATEUR IN COLLECTING, PRESERVING, AND SETTING UP NATURAL HISTORY SPECIMENS OF ALL KINDS doc
... the actual setting up of animals as specimens I can find no trace I doubt, however, if we can carry taxidermy proper farther back than to about 150 years ago, at which date naturalists appear ... the various species of animals are found — an advance in art not dreamed of fifty years ago — and also correctly model the heads and limbs of animals, we still hold our own, and are as far advanced ... two-and -a- half yards wide, and are made with a three-quarter mesh of what is technically called two-thread The staves at each end, to which the nets are permanently attached, are made of red deal,...
Ngày tải lên: 06/03/2014, 13:20
Four Trails: A Quartet of Country Tales
... recall what I was sixteen and a bit of a rascal, always got scoldings." "You Grandpa? Mama told me you was always GIVING scoldings!" said Betty "That came later When I was young, I got them," said ... old place had been repaired many times over the years and there was hardly a board that Keoni had not laid hands on: three bedrooms, a small kitchen, one bathroom, a covered garage with a wash ... house and a dilapidated horse barn out back The barn had long fallen into disrepair from lack of use and maintenance It had been many years since he had ridden, not since the time he was thrown and...
Ngày tải lên: 06/11/2012, 17:33
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... picture of an American woman in the late 1920s Doreen Sulivan, a beautiful woman from Philadelphia, had an appearance which was a fashion of the day with a thin, sleeveless dress over a light camisole, ... United States Barack Obama who has made a history in American presidency to be the first black to hold the office African American have gained recognizable stand in American society that they ... leading in their big mansions… Smoking jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another...
Ngày tải lên: 07/11/2012, 15:01
300 best jobs without a four year degree
... database, so every job has at least one listed We identified any additional knowledge area with a rating that was higher than the average rating for that knowledge area for all jobs We listed as ... that a problem with such data is that it describes an average Just as there is no precisely average person, there is no such thing as a statistically average example of a particular job We say ... sample by the Bureau of Labor Statistics It tells us the average annual pay received as of May 2007 by people in various job titles (actually, it is the median annual pay, which means that half...
Ngày tải lên: 09/08/2013, 13:23
Reading Theory as a Microcosm of the Four Skills
... social and cultural programme, which they are free to, and do, participate in This group will be familiar to many EFL teachers as they are the backbone of many schools in Ireland and Britain ... processing are still tentative, they suggest that basic strategies focusing on the most important words in a text for example, and activating background schemata are the same in listening and reading ... is in their emphasis It is my belief that in giving the L2 student both as much input and practice as they can reasonably manage, and a strong metalinguistic awareness, we, as teachers give the...
Ngày tải lên: 06/09/2013, 10:10
Ebook - Web Analytics: An Hour A Day (Phân tích Web: mỗi ngày một giờ)
... of JavaScript are added to each page and are fired off when the page loads and send data to a data collection server Here is a sample of a complete JavaScript tag that is used by a new web analytics ... teachers over the years, each of whom had a significant impact on me from their teachings and presence Mr and Mrs Paranjapee and Ms Lalitha Mishra at Gyan Dham School in Vapi, Professor Narayana ... Page ii Avinash Kaushik writes about web analytics in a clear, absorbing, and insightful way Web Analytics: An Hour a Day is an essential source for beginners and advanced users, presenting basic...
Ngày tải lên: 29/12/2013, 20:12
Tài liệu Cyber Forensics—A Field Manual for Collecting, Examining, and Preserving Evidence of Computer Crimes ppt
... this information are advised and encouraged to confirm specific claims for product performance as necessary and appropriate The legal/financial materials and information that are available for ... Brent participates in the St Louis InfraGard chapter John W Rado is a geospatial analyst at National Imagery and Mapping Agency (NIMA) in St Louis, Missouri John has worked for NIMA since January ... takes a critical "leap of faith" on the part of the auditor/security professional: that the organization does indeed maintain an e−mail log/file and also archives all e−mail traffic Additionally,...
Ngày tải lên: 18/01/2014, 06:20
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
... DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 randomized oligonucleotides in the center, i.e CTGTCAGTGAT GCATATGAACGAATN10AATCAACGACATTAGGATC CTTAGC was synthesized A 100 ng sample ... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and ... Industrial Science and Technology, MITI, Japan, and of an STA fellowship from the Science and Technology Agency of Japan This study was also supported partially by a grant issued by the National Natural...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu CHAPTER TwENTY ONE A BIOLOGICAL APPROACH TO A MODEL OF AESTHETIC ExPERIENCE OSHIN VARTANIAN AND MARcos NADAL pdf
... network than before, again including the occipital, temporal, and the frontal lobes, but in particular bilateral orbital frontal corlex What the results of Kawabata and Zeki (2004) and Skov ef al (2005) ... neural correlates of preference and beauty, two variables that have affective and cognitive components The areas activated by Vartanian and Goel (2004b) may have highlighted those cOrlical structures ... contrast, the studies by Kawabata and Zeki (2004) and Skov ef al (2005) attempted to isolate those cortical structures that are actIvated more when a stimulus is evaluated as beautiful Presumably,...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Four Years A Scout and Spy ppt
... at a distance of two miles and a half south of the city of Newport Beginning near the Licking River, was situated Fort Shaler; a mile and a half east was Fort Stuart, and a mile and a half east ... steamers, loaded down with troops, as they moved along, one after another, at nearly equal distances apart, presented a grand and imposing appearance The weather was mild and pleasant, which added ... for whom I had been an overseer on the French palace plantation He gave me a warm greeting, and said that he was glad that I had come He was at that time in command of the post, and engaged in fortifying...
Ngày tải lên: 21/02/2014, 11:20