coli a longitudinal cohort control study of hospitalized horses

... study and data management; and Rebecca Stanevich and Daniel Yereb formerly of the National Institute for Occupational Safety and Health and Mustafa Dosemeci, formerly of the National Cancer Institute, ... (Table 1) The elevated risk among those with nonmalignant respiratory disease less than years before death may have been reflective of the early stages of lung cancer Statistically nonsignificant ... has been reported in studies of other occupational exposures and cancer risk (19) Possible biological explanations for a plateauing effect include saturation of metabolic activation and enhanced...

Ngày tải lên: 22/03/2014, 17:20

... investigator All NSAIDs and aspirin were considered However, when aspirin was taken as an antiplatelet aggregant for the prevention of cardiovascular diseases (

Ngày tải lên: 13/08/2014, 16:20

... leave work on time Resources Adult and Child Availability of equipment(e.g hoists) Availability of supplies (e.g dressings) Mental Health Availability of equipment (e.g audiovisual, art materials, ... satisfaction data at and 18 months using principal component analysis with varimax rotation and Kaiser normalization to ascertain whether the eight factors (Care, Staffing, Development, Relationships, ... all three branches were amalgamated into one dataset Branch was included as an independent variable in the statistical models and was a significant predictor in just one model where working as...

Ngày tải lên: 18/06/2014, 17:20

... Low SESa QoL Moderate or high SESa Baseline Mean change Mean change Baseline Ra Ia Ia Ra (n = 1239) (n = 401) b Adj diff (95% CI)c Baseline Mean change Mean change Baseline Ra Ia Ia Ra (n = 1117) ... presence of one or more of the above mentioned diseases at follow-up Statistical analysis Descriptive data (means, standard deviation, and percentage) of the baseline characteristics of the intervention ... physically active, reduce their fat intake, and quit smoking Hartslag Limburg, incorporated two strategies: 1) a population strategy aimed at all inhabitants and specifically at low SES groups, and...

Ngày tải lên: 20/06/2014, 15:20

... duration at the time of each visit were reported in years Disease dura- Page of tion was calculated from the date of physician diagnosis of SLE to the date of each visit Disease activity at each ... measurements of these variables in 1,260 patients with SLE, followed up on average for 9.3 years In total, a large dataset of 26,267 individual data points was used in analysis of variability and correlates ... collection and analysis of data, interpretation of results, and preparation of manuscript; DDG, in the study design, collection of data, interpretation of results, and preparation of manuscript;...

Ngày tải lên: 12/08/2014, 14:22

... level of HRQoL 2.4 Statistical analysis Prevalence rates of the total sample at baseline as well as in different age groups were calculated Bivariate analyses with independent variables at baseline ... physical HRQoL was associated with a higher risk for falling 3.1 Prevalence of falls and associated factors 3.2 Prevalence of dizziness and associated factors At baseline a total of 23.2% of subjects ... Hagberg, B., et al (2004) A longitudinal study integrating population, care, and social sevices data The Swedish National Study on Aging and Care (SNAC) Aging Clinical and Experimental Research, 16,...

Ngày tải lên: 25/08/2016, 22:54

... Patients with RA were predominantly Hispanic-American and African-American, whereas control subjects were primarily Caucasian and African-American Patients with RA had experienced their disease ... trochanter, Ward's area, and distal radius) Participants were discharged early in the afternoon of day Biochemical assays Serum obtained at a. m after an overnight fast was used for measurements of IGF-I, ... Arthritis Research & Therapy Vol No Blackman et al matoid cachexia,' accelerated cardiovascular disease, and enhanced mortality in patients with RA [1-3] RA cachexia is manifested by losses of...

Ngày tải lên: 09/08/2014, 10:20

... the manuscript Additional files 12 13 The following Additional files are available online: Additional file An Word file containing a table that shows a table of all SNPs evaluated for association ... and controls, 71% and 72%, respectively, are female; the mean age was 51 ± 13 years in cases and 54 ± 12 in controls Information about RF and anti-CCP antibody status was available for 1,315 of ... the study period and for the first time, received a diagnosis of RA based on the American College of Rheumatology criteria of 1987 [5] All cases were examined and diagnosed by a rheumatologist at...

Ngày tải lên: 09/08/2014, 10:21

... NEI-AED group NEI-AEDs included levetiracetam, lamotrigine, zonisamide, ethosuxamide, topiramate, gabapentin, tiagabine, and pregabalin Oxcarbamazepine (a weak CYP450 inducer) and valproic acid ... including loss of seizure control or inadequate control of neuropathic pain In many parts of the world where HIV is highly prevalent, such as sub-Saharan Africa and parts of Asia, only CYP450 ... second control group was a subgroup of all participants on HAART without any AED use in the NHS (non-AED group), matched (10:1) to each EI-AED patient according to year of HAART initiation and number...

Ngày tải lên: 10/08/2014, 05:22

... medications be treated for metabolic and cardiovascular disease and that collaborations with primary care physicians, diabetes specialists, and cardiologists be established to facilitate appropriate ... between and AM after twelve hours of fasting Laboratory examinations for markers of thrombogenesis and platelet activation are described in Table Statistical analysis We compared values of descriptive ... statistical analysis and made substantial contributions to the analysis and interpretation of the data All authors read and approved the final manuscript Competing interests The authors declare...

Ngày tải lên: 11/08/2014, 16:22

... 46 Athanasiou A, Karkambounas S, Batistatou A, Lykoudis E, Katsaraki A, Kartsiouni T, Papalois A, Evangelou A: The effect of pulsed electromagnetic fields on secondary skin wound healing: an ... this study the even and perpendicular Page of 10 surface of the neck and the relatively small and uncomplicated wounds allowed to take realistic photos and facilitated accurate wound area measurements ... granulation and the risk for bacterial contamination is high [40] Bacterial colonization was evaluated by taking bacterial cultures and also by swabs for cytology in order to count bacteria Samples...

Ngày tải lên: 12/08/2014, 18:22

... were ED12C (AGTGCTTCCTGCTGCTCCCA) and ED31C (CCATTACACAGGCCTGTCCAAAG) and the second round primers used were DR7C (TCAACTCAACTGGTCCAAAG) and DR8C (CACTTCTCCAATTGTCCCTCA) that yield data on 694 nucleotides ... potential contaminants and excluded from all subsequent analyses For the pol gene, we used the primers pro-1 (TTGGAAATGTGGAAAGGAAGGAC) and RT-0 (CATATTGTGAGTCTGTTACTATGTTTAC) with cycles of 50°C ... collection, maintenance and analysis of subject data, including CD4 and viral load levels and resistance patterns GWZ and QS Rousseau CM, Learn GH, Bhattacharya T, Nickle DC, Heckerman D, Chetty S, Brander...

Ngày tải lên: 12/08/2014, 23:21

... non-normal data Both unadjusted (crude) analyses, as well as separate analyses adjusting for A) gender and age, B) income, education and BMI, C) parent-reported behavioural problems, and D) childreported ... the alpha level was set at a two-tailed 5% Ethics The study was approved by the National Data Inspectorate and the Regional Committee for Medical and Health Research Ethics in western Norway Written ... childhood: a longitudinal study of developmental change and association with behavioral problems J Am Acad Child Adolesc Psychiatry 2002, 41(8):964-971 Laberge L, Petit D, Simard C, Vitaro F, Tremblay...

Ngày tải lên: 13/08/2014, 18:21

... use of artistic vs simple visual materials in experimental aesthetics: “In the former case, there is the advantage of studying reactions to real art and the disadvantage that any two works of art ... activity detected by Cela-Conde et al (2004) (dorsolateral), Kawabata and Zeki (2004) (orbitofrontal) and Vartanian and Goel (2004) (anterior cingulate) was associated with positive ratings Additionally, ... them have very similar objectives Cela-Conde et al (2004) aimed to locate “brain areas activated during the visual perception of aesthetic objects” (Cela-Conde et al., 2004, p 6321) Kawabata and...

Ngày tải lên: 19/02/2014, 17:20

... was veried by calculation of the activation energy using different analytical transformations to t of the experimental data The values of the average energy of activation, Ea, presented in Table ... the range of low scan rates, but for higher scan rates, it reaches a noticeable plateau Such a relationship between Tmax and scan rate indicates that this type of equilibrium thermodynamic analysis ... mgặmL)1 and at vefold molar excess of Tc per mol of the dimer The denaturation enthalpy values of the proteins (in the absence and presence of ligand) as a function of scan rate are shown in Table A...

Ngày tải lên: 20/02/2014, 02:21

... the acquisition of ROA data of suf®cient quality for reliable analysis A ROA spectrum of rather poor quality of an impure commercial sample of a- casein (composition unde®ned) was reported in an ... The j-casein was prepared by adaptation of two other methods, each of which employs an acid precipitation stage to isolate the whole casein, a calcium precipitation stage to partially separate the ... measured at room temperature ROA data originating in artefacts from bu€er bands have been cut out in some places Fig The backscattered Raman and ROA spectra of recombinant human wild-type tau46...

Ngày tải lên: 21/02/2014, 15:20

... Luginaah I, Laukkanen E, Hellyer D, Reinhartz A, Watterson A, Abu-Zahra H, Maticka-Tyndale E, Schneider K, Beck M, Gilbertson M: Occupation and breast cancer: a Canadian case– control study Ann ... Holland (database administrator); Karen Jones, Jane McArthur, Catherine Lott, Jennifer Scane, Teresa Mayne, Ashley Scali, and Nicole Mahler (research associates); Carol Walleyn and Tanya Zillich ... Canadian Breast Cancer Foundation – Ontario Page 15 of 17 Region, Breast Cancer Society of Canada, Windsor Essex County Cancer Centre Foundation, and Green Shield Foundation The Canada Research...

Ngày tải lên: 06/03/2014, 02:21

... Michigan 15 HUMAN RESOURCES DEVELOPMENT CANADA 1992 National Occupational Classification Ottawa, Canada 16 STATISTICS CANADA 1998 North American Industrial Classification System Ottawa, Canada 17 ... histories of breast cancer patients year research grant from Canadian Breast Cancer Research Foundation—Ontario Chapter 60 BROPHY, J., M KEITH, I LUGINAAH, et al 2003 Occupational histories of breast ... Family history of breast cancer, particularly with respect to having two or more relatives with breast cancer and mutation of the BRCA1 and BRCA2 gene, can explain less than 10% of breast cancer...

Ngày tải lên: 06/03/2014, 02:21

... Mfinanga SG, Mutayoba BK, Kahwa A, Kimaro G, Mtandu R, Ngadaya E, Egwaga S, Kitua AY: The magnitude and factors associated with delays in management of smear positive tuberculosis in Dar es Salaam ... da Saude Secretaria de Vigilancia a Saude Programa Nacional de DST/AIDS: riterios de definicao de casos de aids em adultos ecriancas Brasilia, Ministerio da Saude: Ministerio da Saude, Secretaria ... delay, in the univariate model were: - clinical variables: weight loss, asthenia, sweating and chest pain; - variables related to habits and lifestyle: use of marijuana, cocaine and crack; - variables...

Ngày tải lên: 06/03/2014, 04:20

... each instance, the sample with the higher call-rate was retained in the analysis Analysis of association statistics After sample and SNP quality control, statistics of association were calculated ... Faculty, University of Indonesia, Jakarta, Indonesia 8Samara Oblast Tuberculosis Dispensary, Samara City, Samara, Russian Federation 9Clinical TB and HIV Group and Health Protection Agency, National ... SNPs on a pair of oligonucleotide arrays Nat Methods 2004, 1(2):109-111 12 Sahiratmadja E, Alisjahbana B, de Boer T, Adnan I, Maya A, Danusantoso H, Nelwan RH, Marzuki S, van der Meer JW, van Crevel...

Ngày tải lên: 06/03/2014, 04:20