coherent state evolution in a superconducting qubit from partial collapse measurement 1498

... interpretation and manuscript revision HT was involved in study design, data organization, early data interpretation and manuscript revision All authors read and approved the final manuscript Acknowledgements ... paper and revised the manuscript TB and MHL were involved in the original survey used in this paper, provided the original data and revised the manuscript MDK was involved in data interpretation ... gender, increasing time spent in jail and nonheterosexual identity (p ≤ 0.01 for all) The results of a multivariate model including medical conditions are shown in Table Increasing age and female...

Ngày tải lên: 18/06/2014, 19:20

... interpretation and manuscript revision HT was involved in study design, data organization, early data interpretation and manuscript revision All authors read and approved the final manuscript Acknowledgements ... paper and revised the manuscript TB and MHL were involved in the original survey used in this paper, provided the original data and revised the manuscript MDK was involved in data interpretation ... gender, increasing time spent in jail and nonheterosexual identity (p ≤ 0.01 for all) The results of a multivariate model including medical conditions are shown in Table Increasing age and female...

Ngày tải lên: 18/06/2014, 19:20

... interpretation and manuscript revision HT was involved in study design, data organization, early data interpretation and manuscript revision All authors read and approved the final manuscript Acknowledgements ... paper and revised the manuscript TB and MHL were involved in the original survey used in this paper, provided the original data and revised the manuscript MDK was involved in data interpretation ... gender, increasing time spent in jail and nonheterosexual identity (p ≤ 0.01 for all) The results of a multivariate model including medical conditions are shown in Table Increasing age and female...

Ngày tải lên: 20/06/2014, 16:20

... ultrasensitive and automated biological assays such as sensing, imaging, immunoassay, and other diagnostics applications [1–3] Conventional approaches have focused on inorganic/organic hybrid DNA ... Kuzuya A, Sakai Y, Yamazaki T, Xu Y, Komiyama M: Nanomechanical DNA origami ‘single-molecule beacons’ directly imaged by atomic force microscopy Nat Commun 2011, 2:449 Finkelstein IJ, Visnapuu ... amplification, which are shown in Figures and This is the DNA enhanced signal spectroscopy of peptide quantum dot, which will have a potential applications in cellular imaging, immunoassays, and...

Ngày tải lên: 22/06/2014, 00:20

... desiar erew spalf lasocum lasan dna larO spalf lasocum eht etaerc ot etalap tfos eht fo asocum eht dna etalap drah eht fo muetsoirepocum la te eeL li-eaJ 49 .494-784 ,61 ,5791 tcarP minA llams ... htiw detaicossa eb ot detroper neeb sah yregrus etalap tfelC ]9[ aisanahtue etatcid ro htaed esuac yam ,sesaesid latinegnoc tnatimocnoc rehto ro ,snoitacilpmoc esehT ainomuenp noitaripsa dna noitirtunlam ... a htiw palf lasocum lasan eht gnisiar yb detaerc tcefed eht otni derutus neht saw palf lasocum laro eht ,ytivac laro eht otni detcelfer palf lasocum lasan eht htiW tfelc etalap tfos eht gnola...

Ngày tải lên: 07/08/2014, 18:21

... spatial variability of the gap fraction is accounted in part by averaging K values over a transect [26] However, azimuth variation in transmission cannot be assessed since the PCA provides an averaged ... has variable effects, depending on leaf angle distribution For instance, in coniferous stands (Pinus banksiana Lamb and Picea mariana Mill.), Chen [5] reported a decrease of about % in leaf area ... area The leaf angle distribution in intermediary light conditions (relative available radiation of about 50 % in PAR) was established in a previous work [21]by measuring with a protractor leaf...

Ngày tải lên: 08/08/2014, 14:21

... determination of polymorphisms in codons 54 and 57, a fragment of 315 base pairs (bp) was amplified using the following primers: 5'-ATAGCCTGCACCCAGATTGTAG-3' (forward primer) and 5'-AGAGACAGAACAGCCCAACAC-3' ... 78:245-248 Graudal NA, Madsen HO, Tarp U, Svejgaard A, Jurik G, Graudal HK, Garred P: The association of variant mannose-binding lectin genotypes with radiographic outcome in rheumatoid arthritis Arthritis ... on arterial stiffness in children after Kawasaki disease Pediatr Res 2004, 56:591-596 Pratsidou-Gertsi P, Kanakoudi-Tsakalidou F, Spyropoulou M, Germenis A, Adam K, Taparkou A, Siamopoulou A, ...

Ngày tải lên: 09/08/2014, 08:22

... femoral head in the adult is through the intra-osseous and capsular vessels, emanating mainly from the medial circumflex femoral artery, a branch of the profunda femoris artery When a displaced intra-capsular ... bicycle pedals As such users risk only finding out that they have over tightened the binding mechanism when they cannot release their foot in an emergency resulting in a fall and a potential injury ... serves as a reminder of the importance of appropriate advice, especially from manufacturers and retailers, regarding the proper setup and dangers of using clipless pedals for the recreational cyclist...

Ngày tải lên: 10/08/2014, 23:21

... Columbia, Canada (HOMER cohort) [34] and the large International HIV Adaptation Combined (IHAC) cohort, including 1,845 individuals from British Columbia, Canada; Western Australia and the USA (Figure ... guidance; Dr Luis Padilla-Noriega and Dr Eduardo Garc a- Zepeda for their academic counselling We thank Dr Indiana Torres, Dr Beatriz Ramírez, Dr Adakatia Armenta, Dr Jaime Andrade and Dr Lucero González ... collaborative study AIDS Vaccine, Abstract P09-01; Cape Town, South Africa 2008 Barquera R, Zuniga J, Hernandez-Diaz R, Acuna-Alonzo V, MontoyaGama K, Moscoso J, Torres-Garcia D, Garcia-Salas...

Ngày tải lên: 12/08/2014, 23:21

... Sicuranza and A Carini, “Nonlinear multichannel active noise control using partial updates,” in Proceedings of IEEE International Conference on Acoustics, Speech, and Signal Processing (ICASSP ... Steady -state behavior We are here interested in the estimation of the mean-square error (MSE) and the mean-square deviation (MSD) at steady state The adaptation rule of (15) provides different values ... FX-PE-AP algorithm and (b) FX-AP algorithm with a nonlinear controller and I = 1, J = 2, K = The dashed lines diagram the asymptotic values of the residual power A Carini and G L Sicuranza 10 1...

Ngày tải lên: 22/06/2014, 22:20

... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized ... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying the ... questionnaire Patients Patients included Female Male AVNRT AVRT EAT From symptom to diagnosis (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications...

Ngày tải lên: 03/11/2012, 11:44

... TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc ... cultivation Table shows the strains examined in this study MD-1 strain was isolated from Lake Kasumigaura in Japan (Saito et al., 200 3a) MD-1 strain can degrade the microcystin analogs, microcystin-RR, ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities...

Ngày tải lên: 05/09/2013, 10:15

... that similar to Table 5, the available wind power in this case is less compared to that in Tables and because the wind turbine diameter in this case is Da=8 ft compared to that in configurations ... again Therefore, assuming a wind of velocity V facing the turbine at a height of 50 ft from the ground is a reasonable and good approximation for the calculations The wind velocity in a vertical ... surrounding the turbine has a significant effect in increasing the turbine power as well as the turbine efficiency which further increases with increase in ∆T Also, it can be seen that larger diameter...

Ngày tải lên: 05/09/2013, 14:59

... containing the image from the database Create a SQL statement to retrieve the required image from the database and retrieve the image using a DataReader A DataTable or DataSet filled using a DataAdapter ... the image as a binary stream The BinaryWrite( ) method of the HttpResponse object writes a stream of binary characters to the HTTP output stream rather than a textual stream Response.BinaryWrite((byte[])dr["Photo"]); ... image from the database and serves it to the Image control on the web page that the client sees The following steps outline the required tasks: Create a web page that outputs a binary stream...

Ngày tải lên: 28/10/2013, 18:15

... that are bound to the same data source so that they display information from the object within the data source, such as a row in a DataTable The BindingContext class is used to instantiate a BindingManagerBase ... CurrencyManager notifies all data-bound controls if the current item changes so that they can refresh their data The PropertyManager class inherits from the BindingManagerBase class and maintains ... private BindingManagerBase bm; // private void DisplayDatabaseImageForm_Load(object sender, System.EventArgs e) { // Create the DataSet ds = new DataSet( ); // Create the DataAdapter and retrieve...

Ngày tải lên: 28/10/2013, 18:15

... building a Web site that a user can order products from, store their shopping cart in the database Using a DataGrid Control to Access a Database A DataGrid allows you to access rows in a database ... to create a DataSet object You use a DataSet object to store a local copy of the information stored in the database A DataSet object can represent database structures such as tables, rows, and ... online documentation Storing Information using the Database If you have a large amount of information to store about a user, store it in the database rather than the Session object For example,...

Ngày tải lên: 24/12/2013, 01:17

... and innovation to be appreciated The media are important as a source of information on progress in research and innovation: they also draw attention to the balance of advantage and disadvantage ... explains the fact that the available data dates back to 1996 A cross-country comparison of the innovation indicators can help identify national strengths, and areas of weaknesses that are amenable ... Member States and sectors as a means of comparing best practice, – Translating these European guidelines into national and regional policies by setting specific targets and adopting measures, taking...

Ngày tải lên: 16/01/2014, 16:33

... on the aromatic moiety of dibenzoylhydrazines on larvicidal activity against the Colorado potato beetle Leptinotarsa decemlineata Pest Manag Sci 57, 858–865 Nakagawa Y, Minakuchi C, Takahashi K ... candidate insecticidal compounds showing both inductive and potentiative activity Results The DNA-binding domains (DBDs) of Leptinotarsa and Drosophila EcR and USP are identical at every amino ... Ogura T, Minakuchi C, Nakagawa Y, Smagghe G & Miyagawa H (2005) Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato...

Ngày tải lên: 18/02/2014, 08:20

... judiciary, and a general system of checks and balances, to protect public liberty against corruption and to safeguard the equal individual rights of all citizens against each other and against the state ... sides in the shallow academic culture wars had approached republican doctrine in the spirit of litigants, quarrying history for partisan advantage, without real interest in learning from the past ... disciples differed from its Roman, Polybian, and later American antecedents in its greater reliance on unanimity in the public assemblies, rather than checks and balances, to guard against faction.121...

Ngày tải lên: 18/02/2014, 11:20

... reference-free averages generated by translational and rotational alignment of single c rings showed the same stoichiometry (Fig 2D,E) From both the raw data and averages of c rings, it was clear that they ... to be invariable as all the enzymes analyzed so far have a a3b3 (F1F0) or A3 B3 (A1 A0, V1V0) stoichiometry [28] The uncertainty lay in the number of ion-translocating subunits in the membrane-embedded ... protein concentration of samples was determined according to the Lowry method [47], with BSA as a standard Purification of c rings from A woodii F1F0 ATP synthases The ATP synthase from A woodii was...

Ngày tải lên: 18/02/2014, 17:20