co combustion of coal a rice husk and eucalyptus bark
Chlorine free extraction of cellulose from rice husk and whisker isolation
Ngày tải lên :
08/10/2014, 06:05
... Cabrales, L., & Abidi, N (2010) On the thermal degradation of cellulose in cotton fibers Journal of Thermal Analysis & Calorimetry, 102, 485–491 Chandrasekhar, S., Satyanarayana, K G., Pramada, ... Alemdar, A. , & Sain, M (2008) Isolation and characterization of nanofibers from agricultural residues – Wheat straw and soy hulls References and further 1137 reading may be available for this article ... aspect ratio around 18 Such a value of aspect ratio is adequate for application of RH whiskers as nanofillers in polymer matrices In this way the use of rice husk as a novel material source allows...
- 8
- 513
- 1
facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors
Ngày tải lên :
19/03/2014, 16:48
... thermal analysis (TG-DTA) of the as-prepared R-FeOOH precursor was conducted on a ZRY2P thermal analyzer Ten milligrams of an R-FeOOH sample was heated from room temperature to 600 °C in air at a ... Sensitivities of porous R-Fe2O3 nanorods to various gases of 50-1000 ppm area and a relatively large particle size, whereas the sensor based on porous R-Fe2O3 nanorods has a high surface area and tiny ... nanorods would be an ideal candidate for applications in ethanol sensors Other properties and applications, such as catalysts and fuel cells, may also be found Acknowledgment The authors thank...
- 5
- 458
- 1
Báo cáo khoa học: Crystal structure of RNase A tandem enzymes and their interaction with the cytosolic ribonuclease inhibitor potx
Ngày tải lên :
22/03/2014, 16:21
... RI, was loaded onto an RNase A affinity column For affinity chromatography, RNase A was attached covalently to the resin of a 5-mL Crystal structure of RNase A tandem enzymes HiTrap NHS-ester column ... reaction was started by addition of FAM-AUAA-TAMRA (final concentration 50 nm) After a distinct time interval, lL of trypsin (0.5 mgÆmL)1) was added The reaction was finalized by addition of lL of ... constrain the ability of the RNase A entities to adopt the same orientation in the crystal as monomeric RNase A On the other hand, the decreased activity of the RATEs as compared with RNase A...
- 10
- 535
- 0
Báo cáo khoa học: Chromophore attachment in phycocyanin Functional amino acids of phycocyanobilin – a-phycocyanin lyase and evidence for chromophore binding doc
Ngày tải lên :
23/03/2014, 10:21
... CGGGCAAATGACAGCAGCTGTA-3¢, upstream; P10: 5¢-AAACCCGGGCGCAGTGTAGCTGAAG-3¢, upstream; P11: 5¢-CCCCTCGAGCCCTTAAATTGGTTGTTGTA-3¢, downstream; P12: 5¢-ATACCCGGGATGACTGCCACTA CTCAACAATTAAAACGT-3¢, upstream; ... upstream; P2: 5¢-GGGCTCGAGCGGCAATTAAAGTGG GAAT-3¢, downstream; P3: 5¢-ATACCCGGGATACTCCT GACCATGACTGC-3¢, upstream; P4: 5¢-ACCCTCGAGT TATCTTGAGAGTGGAACAAA-3¢, downstream; P5: 5¢-ATGCCCGGGGGTAAGTTTCGCGTTCG-3¢, ... upstream; P6: 5¢-GGGCTCGAGTTACATCAAATTCATGACTCG-3¢, downstream; P7: 5¢-CCCCTCGAGCTTGCTACAATTAT GAATCCA-3¢, downstream; P8: 5¢-ACCCTCGAGTTATT TTCTACCTTGGCCAGC-3¢, downstream; P9: 5¢-TGTCC CGGGCAAATGACAGCAGCTGTA-3¢,...
- 13
- 436
- 0
A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL – A technological, economic and ecological investigation based on case studies pot
Ngày tải lên :
29/03/2014, 17:20
... 0,6 0,3 0,6 0,3 Small scale, high raw material price Small scale, low raw material price Large scale, high raw material price Large scale, low raw material price Conversion costs €/kg 0,2 0,2 ... a paperand-pencil administration First, responses automatically went into a database that was available for analysis at all times This allowed for monitoring of survey progress and eliminated ... molecules.18 Basically, a large amount of feedstock sources are available Besides the traditional crops as rapeseed and sunflower they also include peanut, cottonseed, lard, linseed, tung, cocoa, hemp and...
- 164
- 601
- 3
báo cáo sinh học:" Key factors leading to reduced recruitment and retention of health professionals in remote areas of Ghana: a qualitative study and proposed policy solutions" doc
Ngày tải lên :
18/06/2014, 17:20
... impact Data on professional needs and priorities are essential, as professional aspirations change rapidly While evidence suggests that strategies may require a mix of financial and non-financial ... gather such data from rural and urban doctors, as well as medical leaders, on both the real and perceived challenges of rural medical service in Ghana We gathered data from medical leaders across ... years of rural service can glean some advantages as well, through a scaled program (10% and 20%, respectively), of added marks towards their entrance application Such a program offers potential...
- 11
- 707
- 0
báo cáo hóa học:" Tooth loss and oral health-related quality of life: a systematic review and meta-analysis" potx
Ngày tải lên :
20/06/2014, 15:20
... Naito M, Suzukamo Y, Nakayama T, Hamajima N, Fukuhara S: Linguistic adaptation and validation of the General Oral Health Assessment Index (GOHAI) in an elderly Japanese population J Public Health ... M, Bedi R, Zaki AS: Translation and validation of an Arabic version of the UK oral health related quality of life measure (OHQoL-UK) in Syria, Egypt and Saudi Arabia Community Dent Health 2003, ... meta-analysis of data of a Greek and a British population (Figure 5) Although associated, the correlation between number of missing teeth and Gerritsen et al Health and Quality of Life Outcomes...
- 11
- 654
- 0
Báo cáo hóa học: " Weak reverse Hölder inequality of weakly A-harmonic sensors and Hölder continuity of A-harmonic sensors" potx
Ngày tải lên :
20/06/2014, 22:20
... for each Wang and Bao Journal of Inequalities and Applications 2011, 2011:99 http://www.journalofinequalitiesandapplications.com/content/2011/1/99 Page of 10 holds, then for all a1 , a2 Î D, d (a1 , ... Wang and Bao Journal of Inequalities and Applications 2011, 2011:99 http://www.journalofinequalitiesandapplications.com/content/2011/1/99 Page of 10 which also holds for differential forms, and ... Wang and Bao Journal of Inequalities and Applications 2011, 2011:99 http://www.journalofinequalitiesandapplications.com/content/2011/1/99 Page of 10 then Equation (1.1) simplifies to the p-harmonic...
- 10
- 231
- 0
báo cáo khoa học: "A rare combination of an endocrine tumour of the common bile duct and a follicular lymphoma of the ampulla of Vater: a case report and review of the literature" ppt
Ngày tải lên :
09/08/2014, 01:24
... invasion of adjacent tissues, and vascular and perineural invasion Available data extrapolated from the existing literature suggest that carcinoid tumours of the extrahepatic biliary tree are of ... carcinoma (malignant carcinoid) of the extrahepatic biliary tract: report of two cases and literature review APMIS 2010, 118:543-556 Yoshino T, Miyake K, Ichimura K, Mannami T, Ohara N, Hamazaki ... neoplasm However, the final diagnosis revealed a follicular lymphoma of the duodenum and a carcinoid tumour of the CBD No adjuvant therapy was judged appropriate after thorough staging and the patient...
- 4
- 427
- 0
Báo cáo khoa học: "Inflammatory myofibroblastic tumor of epididymis: a case report and review of literature" potx
Ngày tải lên :
09/08/2014, 07:22
... eight cases and our case has been presented in table Based on the clinical examination the differential diagnosis of such a mass is testicular tumor, adenomatoid carcinoma, paratesticular sarcoma, ... analysis, and interpretation, manuscript drafting and final approval WPW was involved in acquisition of data, data analysis, provided pathologic imaging, Page of (page number not for citation purposes) ... surgical exploration Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for...
- 6
- 442
- 0
Báo cáo y học: " Acceptability of Carraguard, a candidate microbicide and methyl cellulose placebo vaginal gels among HIV-positive women and men in Durban, South Africa" pps
Ngày tải lên :
10/08/2014, 05:20
... arm) and real use acceptability was assessed All male partners were consented, and offered voluntary counseling and testing for HIV A total of 72 IDI were conducted among: 19 of 20 sexually abstinent ... HHM, Braunstein Sarah L, Morar Neetha S, Jones Heidi E, Madurai Lorna, Evans Strickfaden Tammy T, Moodley Manivasan, Aboobaker Jamila, Ndlovu Gugulethu, Ferguson Taja M, Friedland Barbara A, Hart ... study was undertaken to assess the safety and acceptability of Carraguard among HIV positive sexually active and abstinent women and sexually abstinent men The outcome of the safety paper is...
- 10
- 346
- 0
báo cáo khoa học: " Proteomic identification of OsCYP2, a rice cyclophilin that confers salt tolerance in rice (Oryza sativa L.) seedlings when overexpressed" pptx
Ngày tải lên :
11/08/2014, 11:21
... 5’-GCCTTTCGCCAGTATCAGTC-3’, OsCYP2-R: 5’-CAGATCCAACTCCACCGAAT-3’; Actin-F: 5’-GACCTTGCTGGGCGTGAT-3’, Actin-R: 5’-GTCATAGTCCAGGGCGATGT-3’ Preparation of antiserum and western blot analysis According ... days at 25°C The NaCl solution was changed every day to maintain a constant concentration of NaCl Page 11 of 15 15 at 15000 × g The supernatant was collected in a 1.5-ml tube, and a 40 μl sample ... and biochemical assays JXT participated in physiological analysis SZW participated in gene transformation HZC participated in phenotype identification and statistical analysis All authors read...
- 15
- 404
- 0
Báo cáo y học: "Exudative pleurisy of coccidioidomycosis: A case report and review of the literature" pps
Ngày tải lên :
11/08/2014, 21:22
... LDH ratio, 0.7) Bacterial Gram stain and culture, acid-fast bacilli smears, fungal culture and cytology were all negative Histopathological evaluation of the pleural biopsy noted granulomatous ... increasing, with the majority of reports from the states of Arizona and California There is particular risk associated with outdoor activity owing to seasonal precipitants and aerosolization of ... azoles voriconazole and posaconazole appear to be effective in small clinical trials but are not yet suitable to be considered as first-line therapy In small clinical trials, the use of posaconazole...
- 3
- 233
- 0
Báo cáo y học: " Coliform pyosalpinx as a rare complication of appendicectomy: a case report and review of the literature on best practice" pdf
Ngày tải lên :
11/08/2014, 23:21
... [13,14] Tubal function may also be assessed by salpingography and/ or salpingoscopy A "cobblestone" appearance of the tubal mucosa is suggestive of patchy loss and damage to ciliated mucosal cells ... patency and mucosal architecture can be assessed subsequently, by salpingography and salpingoscopy Repeat diagnostic laparoscopy may also be useful in assessment of premenopausal females who have had ... irrigated generously with a 0.9% saline and Betadine mixture Microbiological analysis of the pus revealed Escherichia coli and anaerobes but not Chlamydia or Candida spp A postoperative Gastrografin...
- 3
- 346
- 0
Báo cáo sinh học: " SNP mapping of QTL affecting growth and fatness on chicken GGA1" pptx
Ngày tải lên :
14/08/2014, 13:22
... CTGCTTGCAGACCTCTAGGC ATACAGGCCAAGCACAGGAA CTTCCCACCAACGTTCTGTT CCAAAGCTCTGAAAGGCAAG AATTCATCCCTCCAGCACAG CTCTCTGCATGCCTTCACTG ATCCGTGGTTTGGTATTGGA CCACTTTGCTGCAGTCGTTA CACCCAAACAGTCCCATTTT ATTTGCCATGCAGCTTCTTT ... TGCAACACAAGATGCTTTCC CATGGATGCTTTCAGCTTCA TGGGCAGGTAGAGAGCTGTT CTGCTTTTCCCCTTTCTCCT GGGGGAAGACTGCTGCTTAT ATGCCAAACCACCATTGACT AGGGCTGACAGCTGGTTTTA ACTTCCAACAGCCCATTCTG CTGGCTGCAGGAGAGTAAGC AAGCTGCCAAACAAAACCAG ... AATCCCTCGTTCATGATGGT TAAGCTAGCAGGGCAGTCGT GCTCAGTTTTGGACCTGCTC GGCTTCCTCTGCACAACTTC TGTCCGGAAGAGAAGAGGAA AGCCTGGTTCCATGACAAAC GTGAGCTTCTGTGGTGCAAA CGAGAACCACTCCCATCTGT TGCATGGAGACAACTGGGTA GGGCTCCTGACGTGGTATTA...
- 14
- 312
- 0
Structural and functional characterization of TRX16, a thioredoxinlike protein and altering substrate specificity of a serine protease inhibitor
Ngày tải lên :
09/09/2015, 18:55
... Farré and Casado, 2001; Laroux et al., 2001), atherosclerosis and other cardiovascular disorders, inflammation and chronic inflammation (Laroux et al., 2001; Latha and Babu, 2001), burns (Latha ... words can express the profound respect and gratitude I have for my supervisors Prof K Swaminathan and Prof J Sivaraman I thank them for their perpetual guidance, unceasing cooperation and constant ... 3-dimensional structure, as structure and function go hand in hand Decades of effort using X-ray crystallography and NMR have produced thousands of protein and complex with binding partner structures and...
- 145
- 254
- 0
In situ catalytic conversion of tar using rice husk char/ash supported nickel–iron catalysts for biomass pyrolytic gasification combined with the mixing-simulation in fluidized-bed gasifier
Ngày tải lên :
02/08/2016, 09:35
... and char characterization 2.4 Sampling and analysis Biomass feedstock of RH was collected from Thailand Table shows the properties of RH, RHC and RHA including the ultimate The condensable tar ... TGA and the X-ray diffraction (XRD, Rigaku, XRD-DSC II, Japan), respectively 2.3 Biomass gasification and tar conversion Materials and methods The main experimental parameters of operating condition ... supported catalysts ascribed to the methanation reactions between CO2 , C and H2 In addition, char itself could play the role of an adsorption-type catalyst for tar and CO2 conversion Because of char...
- 12
- 392
- 0
Báo cáo khoa học: " Germination of Pinus pinaster, P. radiata and Eucalyptus globulus in relation to the amount of ash produced in forest fires Otilia" doc
Ngày tải lên :
08/08/2014, 14:21
... González-Rabanal and Casal [17], Neéman et al [25], Thomas and Wein [32] and Trabaud and Casal [36] Neéman et al [25] found that a thick layer of ash had a negative effect on seed germination, but ... populations dynamics of jarrah (Eucalyptus marginata Donn ex Sm.) regeneration in Western Australian forest, Aust J Bot 32 (1984) 353-362 [2] Abbott I., Loneragan O., Ecology of jarrah (Eucalyptus ... (Eucalyptus marginata) in the northern jarrah forest of Western Australia, Dept Conserv Land Manage., W Australia, Bull No I (1986) 137 pp [3] Ahlgren C.E., Small mammals and reforestation following...
- 9
- 401
- 0
A White Paper Describing Produced Water from Production of Crude Oil, Natural Gas, and Coal Bed Methane pot
Ngày tải lên :
09/03/2014, 01:20
... 30,641 No data available 29,768 6,943 No data available 78,530 No data available 50,857 No data available 162,739 No data available 1,596 No data available 867,122 40,792 No data available 3,555 ... State (1,000 bbl) State Alabama Alaska Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Louisiana Michigan Mississippi Missouri Montana Nebraska Nevada New Mexico ... TABLE 3-1 Annual Onshore Produced Water Generation by State (1,000 bbl) State Alabama Alaska Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Louisiana Michigan Mississippi...
- 87
- 559
- 0