climbing a ladder of higher meaning

A study of metaphoric meanings of words denoting weather in english and vietnamese

A study of metaphoric meanings of words denoting weather in english and vietnamese

... that the word storm in (2) has had a lot of transfers in their root meanings - Examine the metaphoric meanings of words denoting weather - Analyze and make a comparison of metaphoric meanings of ... defined as the state of being fairly cold, not hot or warm Below are the metaphoric meanings of cool 4.4.1.1 Pleasantly cool giving out at a fairly temperature in a way that is pleasant, rather ... Metonymy is characterized by association, whereas 2.2.8 Summary metaphor establishes a relationship of similarity.” 2.4.7 Weather and Weather Metaphors 2.4.6.1 Weather and Climate a Weather Webster’s...

Ngày tải lên: 26/11/2013, 13:23

13 1,2K 2
Báo cáo sinh học: " Periodic solutions for a class of higher order difference equations" potx

Báo cáo sinh học: " Periodic solutions for a class of higher order difference equations" potx

... for a class of higher- order difference equations Huantao Zhu1 and Weibing Wang∗2 Hunan College of Information, Changsha, Hunan 410200, P.R China Department of Mathematics, Hunan University of Science ... the NNSF of China (10871063) and Scientific Research Fund of Hunan Provincial Education Department (10B017) References [1] Agarwal, RP: Difference Equations and Inequalities, 2nd edn Marcel Dekker, ... Schauder’s fixed point theorem is crucial in our arguments Lemma 3.2 [16] Let X be a Banach space with D ⊂ X closed and convex Assume that T : D → D is a completely continuous map, then T has a...

Ngày tải lên: 18/06/2014, 22:20

14 315 0
BÀI GIẢNG TOÁN CAO CẤP (A COURSE OF HIGHER MATHEMATICS)

BÀI GIẢNG TOÁN CAO CẤP (A COURSE OF HIGHER MATHEMATICS)

...  alim   x2 dx  alim arctan x  a  alim (  arctan a)     Ví dụ 12  a Ví dụ 13  b 1   x2 dx  alim   x2 dx  blim   x2 dx     a  lim (  arctan a)  lim arctan ... (  Ax  A  B), yr  e ( Ax  A  B) Thay vào phương trình cho, ta " ' yr  yr  yr  (6 x  7)e x  e x ( Ax  A  B)  e x (  Ax  A  B)   e x ( Ax  B)  (6 x  7)e-x  (6 Ax  A  ... a a c  f ( x)dx   f ( x)dx  f ( x)dx a  Nếu f(x) hàm số chẵn (ngh a f (  x)  f ( x) ) a  f ( x )dx  f ( x )dx a a Nếu f(x) hàm số lẻ (ngh a f (  x)   f ( x) )  f ( x )dx  a...

Ngày tải lên: 25/11/2014, 18:41

26 2,3K 21
A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

A contrastive analysis of the meanings expressed via the modal verbs can, may, must in english and the equivalent expressions in vietnamese

... considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical teaching as well as translation ... modal in a certain situation makes clear which meaning is intended An effort has also been made to have a contrastive analysis of the meanings expressed via the modal verbs can, may, must and the ... only a certain meaning but they usually convey a wide range of meanings To have a correct interpretation of a modal, it is suggested to accord a central place to the role of both speaker and hearer...

Ngày tải lên: 29/01/2014, 00:23

39 2,6K 19
Tài liệu A NOTE ON MEASURING THE ECONOMIC IMPACT OF INSTITUTIONS OF HIGHER EDUCATION ppt

Tài liệu A NOTE ON MEASURING THE ECONOMIC IMPACT OF INSTITUTIONS OF HIGHER EDUCATION ppt

... that the skill-base approach is particularly useful in the case of the University of Massachusetts at Boston (UMB), since 89% of undergraduates and 82% of graduates remain in Massachusetts after ... and calculate the economic impact of a university First, carefully identify the region of analysis, which may consist of a metropolitan area, county, state, or multistate area Second, randomly ... traditional economic-base approach He argued that the scope of an economic impact analysis should be expanded to include additions to the skill base of the state; through higher education, a...

Ngày tải lên: 20/02/2014, 19:20

12 500 0
a representation of the true meaning of tragedy

a representation of the true meaning of tragedy

... Suffering was a major step in coaxing John to his realization He suffered mentally and emotionally because of his flaw, as the heat of the accusations intensified He witnessed his wife Elizabeth go ... possibilities of human freedom.'(Kerr) Again, it is Proctor's freedom that makes him a tragic hero 'I cannot mount the gibbet like a saint It is a fraud, I am not that man My honesty is broke, Elizabeth; ... the agony of being accused as a witch he suffers because he too was accused of betraying God Their true suffering becomes apparent when Proctor confesses to adultery to pardon Elizabeth Elizabeth...

Ngày tải lên: 21/03/2014, 21:55

2 320 0
The Business of Higher Education-A Study of Public-Private Partnerships in the Provision of Higher Education in South Africa ppt

The Business of Higher Education-A Study of Public-Private Partnerships in the Provision of Higher Education in South Africa ppt

... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free...

Ngày tải lên: 22/03/2014, 19:20

111 554 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... human human Rhesus monkey mouse Lower primer (5¢- to 3¢) CGGGAACCACTATGCC ACACAAAGCCACTGAA (V) CCCTTCTTGCCATCG (I) GCCGGTTATTTCATAGACAC (II) AAGACGTTTAGGTGCAAT (III) CCCTTTGCTGTTGGAT (IV) TGCCATGAAGATCTTAGA ... human fetal brain, human adult hippocampus, cerebral cortex and amygdala was purchased from BioChain Institute (Hayward, CA, USA) as PCR Ready First strand cDNA Total RNA from human adult brain (1.1...

Ngày tải lên: 30/03/2014, 04:20

13 344 0
rutgers university press a prehistory of the north human settlement of the higher latitudes nov 2004

rutgers university press a prehistory of the north human settlement of the higher latitudes nov 2004

... largely a consequence of warmer climates The peak of the last major glacial advance 24,000 years ago seems to have forced modern humans to abandon large areas of northern Eurasia And rising temperatures ... of soft foods that cause little abrasion and wear on the tooth surface By contrast, human teeth have a comparatively thick coat of enamel, indicating a dietary history of harder and more abrasive ... food resources And because of the increased seasonality of areas at higher latitudes, they also had to adjust to major variations in climate and food availability during the year By adapting to these...

Ngày tải lên: 11/06/2014, 13:33

246 269 0
Báo cáo lâm nghiệp: "Autophagic response of higher plant cells to a prolonged period of sucrose deprivation" docx

Báo cáo lâm nghiệp: "Autophagic response of higher plant cells to a prolonged period of sucrose deprivation" docx

... decrease of NTP was not accompanied by a parallel increase in intracellular NDP and NMP (Fig 4) The NTP/NDP ratio was maintained at a and it was possible therefore that the total amount of NTP per ... intracellular cardiolipin or cytochrome aa In addition, it was esta3 blished that: ) on a protein basis, the rate of uptake in state was about the same for normal and sucrose-starved mitochondria ... intracellular sucrose had been consumed At that stage, starch content was decreased to less than 30% of that of normal cells started declining The fact that the rate of consumption sucrose starvation...

Ngày tải lên: 09/08/2014, 04:20

10 182 0
Báo cáo y học: "Association of PTPN22 1858 single-nucleotide polymorphism with rheumatoid arthritis in a German cohort: higher frequency of the risk allele in male compared to female patients" potx

Báo cáo y học: "Association of PTPN22 1858 single-nucleotide polymorphism with rheumatoid arthritis in a German cohort: higher frequency of the risk allele in male compared to female patients" potx

... study, oversaw all aspects of the laboratory work, analyzed the data and prepared the manuscript SK, SA, MW and CB participated in the collection of clinical data and the recruitment of patients ... clinical use Detection of anti-CCP antibodies A commercially available, second generation anti-CCP ELISA (Immunoscan RA2, Generic Assays, Dahlewitz, Germany) was used for the quantification of anti-CCP ... decreased activity of regulatory T cells The aim of this study was to analyze the association of the 1858C/T SNP with RA in a sample set comprising 390 German white RA cases and 349 healthy German...

Ngày tải lên: 09/08/2014, 08:22

7 421 0
semantic density mapping a discussion of meaning in william blake’s songs of innocence and experience

semantic density mapping a discussion of meaning in william blake’s songs of innocence and experience

... scan a text for synonyms, and disambiguating words using Part -of- Speech (POS)18 tagging (Van Atteveldt 2008: 48) Offering as an example that ‘safe as a noun (a money safe) and as an adjective (a ... potential application of semantic network mapping as a language discovery tool Of course, the discussion of the results above is suited to a 46 proof -of- concept rather than an application of SD analysis ... limitation, Gephi was expertly capable of handling the large amount of data necessary to this project, and was the clear choice amongst rival software In addition to this, Gephi came prepackaged...

Ngày tải lên: 22/12/2014, 16:44

71 295 0
a study on the meaning and structure of an english fairy-tale  a systemic functional analysis = nghiên cứu về ngữ nghĩa và cấu trúc của một câu truyện cổ tiếng anh theo quan điểm của ngữ pháp chức năng hệ thống

a study on the meaning and structure of an english fairy-tale a systemic functional analysis = nghiên cứu về ngữ nghĩa và cấu trúc của một câu truyện cổ tiếng anh theo quan điểm của ngữ pháp chức năng hệ thống

... communication and analyses grammar to discover by what means it allows speakers and writers to make and exchange meanings Its main focus is not a clear distinction between grammatical and ungrammatical ... & Hasan 1976: 1) A text is best regarded as a Semantic unit: a unit not of form but of meaning. ” (Halliday & Hasan 1976: 2) From Halliday & Hasan’s point of view we understand that text is a unit ... long time ago”/ “long ago” /“It happened that…”/ “Once there was… “in a far away place” are expressions that often appear at the beginning of an English fairy tale The setting and details about when...

Ngày tải lên: 02/03/2015, 14:22

88 1,1K 6
a study on the meaning and structure of a geography text  a systemic functional analysis = nghiên cứu về nghĩa và cấu trúc của một văn bản địa lý phân tích trên cơ sở lý thuyết chức năng hệ thống

a study on the meaning and structure of a geography text a systemic functional analysis = nghiên cứu về nghĩa và cấu trúc của một văn bản địa lý phân tích trên cơ sở lý thuyết chức năng hệ thống

... relational are manner characterized XXV 31 sayer verbal indicates 32 actor material reduce goal material impair goal material harms goal 35 material damages goal 36 material leaches goal material ... declarative XXIV 29 Others are declarative 30 Ecosystems are declarative 31 Research indicates declarative 32 Acid precipitation may declarative impair declarative harms declarative 35 damages ... For M .A. K Halliday, language is a “system of meanings” That means when people use language, their language acts express meanings From this point of view, the grammar becomes a study on how meanings...

Ngày tải lên: 02/03/2015, 14:22

52 912 0
a study on the meaning and structure of a geography text  a systemic functional analysis = nghiên cứu về nghĩa và cấu trúc của một văn bản địa lý  phân tích trên cơ sở lý thuyết chức năng hệ thống

a study on the meaning and structure of a geography text a systemic functional analysis = nghiên cứu về nghĩa và cấu trúc của một văn bản địa lý phân tích trên cơ sở lý thuyết chức năng hệ thống

... VIET NAM NATIONAL UNIVERSITY, HA NOI UNIVERSITY OF LANGUAGE & INTERNATIONAL STUDIES FACULTY OF POST – GRADUATE STUDIES ***************** DƯƠNG THỊ THẢO A STUDY ON THE MEANING AND STRUCTURE OF A GEOGRAPHY ... 38 APPENDICES ………………………………………………………………………… I Appendix Clause and Clause Complex Analysis ………………………………… II Appendix Transitivity Pattern of the Text ……………………………………… V Appendix Mood Pattern of ... Context of the Chosen Text ……………………………………… 16 2.4 Clause and Clause Complex Analysis ………………………………… 17 2.5 The Analysis of the Text in Terms of Transitivity, Mood and Theme 19 2.5.1 The Transitivity...

Ngày tải lên: 02/03/2015, 14:22

4 504 0
A COMPARATIVE STUDY ON MEANINGS OF WATER RELATING IDIOMS IN VIETNAMESE AND ENGLISH  Nghiên cứu so sánh về nghĩa của các thành ngữ có liên quan đến nước trong tiếng Việt và tiếng Anh

A COMPARATIVE STUDY ON MEANINGS OF WATER RELATING IDIOMS IN VIETNAMESE AND ENGLISH Nghiên cứu so sánh về nghĩa của các thành ngữ có liên quan đến nước trong tiếng Việt và tiếng Anh

... Language as an index of culture  Language as symbols of culture In his first point of view, language is “an inevitable part”, a major part” of culture He emphasizes that language is a part of ... the basis of an element of shared meaning The words in a field share a common “semantic component” A semantic field contains words that belong to a defined area of meaning (Jackson and Amvela, ... opportunities and 27 advantages, circumstances, behaviour, psychological states, physical states, human actions, state of life, danger and challenges, bad fortunes and disadvantages, human character...

Ngày tải lên: 10/05/2015, 11:34

62 929 3
The Influence of Gender and Ethnicity on the Use of ICT in Higher Education  A Case of Arts and Social Sciences Students in Universiti Malaya

The Influence of Gender and Ethnicity on the Use of ICT in Higher Education A Case of Arts and Social Sciences Students in Universiti Malaya

... reputation of Malaysia as a technology leader in a major way In the 1980s, Ratnam had argued in the context of technological growth and industrialization in Malaysia: Before a country can adapt ... in Univerisiti Malaya in Kuala Lumpur—the capital of Malaysia Research Questions The general aim of this study as well as a review of available literature presented in the next chapter led me to ... INPUMA), Mr Hirman Awang (Asst Registrar, INPUMA), Ms Vigneshree King (Asst 5 Registrar, Faculty of Arts and Social Sciences) and other administrative staff at Universiti Malaya Among the faculty...

Ngày tải lên: 14/05/2015, 12:09

125 441 0
Building a culture of innovation in higher education

Building a culture of innovation in higher education

... could be made to advance innovation Leaders are aware of, but unwilling or unable to facilitate, new policies that would enable increased innovation adapting Leaders are aware of, and are actively ... maintain a focus on innovation “Kansas State University’s Innovation Campus in Olathe (greater Kansas City) was launched by funding from a county sales tax increase,” says Prema Arasu, CEO and ... which is treated as actionable data 48 Learning Agenda Managing Change entering There is no evidence of an explicit organizational change management strategy that includes the role of innovation or...

Ngày tải lên: 05/08/2015, 21:19

58 385 0
A Study on the Meaning and structure of an Default fairy-tale a systemic functional analysis

A Study on the Meaning and structure of an Default fairy-tale a systemic functional analysis

... Edward Arnold, Halliday, M A K., and Hasan (1985), Language, Context and Text: Aspect of Language in Social-Semiotic Perspective Geelong, Victoria: Deakin University Press, 6 Halliday, M A K., ... functional analysis” for my thesis, using Halliday’s functional grammar as the theoretical framework 1.2 Aims of the study This thesis attempts to study the meaning and the structure of an English fairy ... data from authentic texts The two approaches are clearly different from each other: the former approach refers to grammatical analysis and it is often called formal while the later one is called...

Ngày tải lên: 10/08/2015, 19:48

4 443 1
w