clients and servers implemented with non c orbs
Distributed data reconciliation and bias estimation with non gaussian noise for sensor network
Ngày tải lên :
14/09/2015, 08:38
... perform local computations, and communicate with one another over a network [1] Termed sensor node, each of these devices is typically small, low cost and battery operated [2] These characteristics ... assigned to the sensor nodes With such autonomy/awareness, these nodes can collaborate and reconcile with their neighbouring nodes, hence reducing unnecessary communication with other parts of the ... Node share the processing and communicate to complete the data reconciliation Table 2.1 (which can be found at the end of this chapter) shows the details Node and each computes and holds its own...
126
235
0
Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"
Ngày tải lên :
25/10/2012, 11:48
... perforation3 Many techniques have been described in order to prevent the consequences of a chronical presence of OAC, such as buccal flap, palatal rotation-advancement flap and buccal fat pad1,3-7 ... presence of a possible communication One hour before the surgical procedure an antibiotic prophilaxis was performed with amoxicillin and clavulanic acid g The fixed partial prosthesis was removed and ... CM, Disch FJ, Tuinzing DB Anatomical aspects of sinus floor elevations Clin Oral Implants Res 2000 Jun;11(3):256-65 Gacic B, Todorovic L, Kokovic V, Danilovic V, Stojcev-Stajcic L, Drazic R, Markovic...
5
573
0
Báo cáo y học: "Weight loss, leukopenia and thrombocytopenia associated with sustained virologic response to Hepatitis C treatmen"
Ngày tải lên :
26/10/2012, 09:39
... mass index; HCV = hepatitis C virus; HIV = human immunodeficiency virus; RNA = ribonucleic acid; SD = standard deviation Table 2: Comparison of demographics, clinical characteristics and laboratory ... male (67%) and Caucasian (57%) with the mean age of 52.5 years (Table 1) Fifty six percent were infected with genotype 1, 16% with genotype and 28% with genotype Clinical characteristics, relevant ... ethnicity, 38 gender, drug abuse, and histology were not significantly associated with SVR To allow for clinical applicability, logistic regression with clinical cut-offs in the significant relevant...
7
519
0
Tài liệu C# and .NET FrameworkProgramming with Microsoft .NET pptx
Ngày tải lên :
23/12/2013, 04:16
... Nội dung giảng Bài 1: C Sharp kiến tr c NET C# Bài 2: Lập trình hướng đối tượng C# Bài 3: Lập trình nâng cao C# Bài 4: C c lớp C# Bài 5: Windows Application Bài 6: Truy c p liệu với NET Bài 7: ... Professional C# , Second Edition http://www.asp.net http://www.microsoft.com/net/default.mspx http://www.codeproject.com Slide nguồn tài liệu tham khảo download tr c tiếp http://www.vtportal.net/nghien-cuu-phattrien/thang-long/tab.aspx ... Nội dung môn h c Nắm ngôn ngữ lập trình C# (C Sharp) Hiểu kiến tr c NET Microsoft Triển khai số ứng dụng NET Framewrok (bài tập) Tiếp c n số hướng lập trình với NET (tùy chọn) Editor: Đoàn...
4
408
0
Direct torque and indirect flux control of brushless DC motor with non sinusoidal back EMF without position sensor
Ngày tải lên :
03/01/2014, 19:45
... significantly less than electrical and mechanical time constant then back-EMF value can be assumed to remain constant During each sampling period and so: deα / dt = 0, deβ / dt = By subtracting ... indirectly using d–axis current Unlike those for motor with sinusoidal back-EMFs, optimal current references for a nonsinusoidal back-EMF motor (BLDC) in the synchronous reference frame are not constant, ... q-axis stator current, (c) d- 0.02 0.01 axis stator current, (d) actual electrical rotor position, (e) estimated -0.01 electrical rotor position, (f) error of actual and estimated electrical -0.02...
5
617
2
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
Ngày tải lên :
18/02/2014, 08:20
... STAT3-speci c or could also interact with STAT1 and disrupt its signalling In colorectal carcinoma cells, treatment with IFN -c sensitizes cells to cytotoxic compounds, and can also induce cell death ... different concentrations of the fluorescein isothiocyanate (FITC)-labelled hpST3d ODN combined with cationic lipid and analysed the intensity of FITC fluorescence by flow cytometry Transfection efficiency ... P21Cip1 is a critical mediator of the cytotoxic action of thymidylate synthase inhibitors in colorectal carcinoma cells Cancer Res 64, 6296–6303 Bene A, Kurten RC & Chambers TC (2004) Subcellular...
11
558
0
Professional ASP.NET 3.5 Security, Membership, and Role Management with C# and VB ppt
Ngày tải lên :
05/03/2014, 22:20
... protocols and services that handle request processing inside IIS 7.0 Protocol Listeners Protocol listeners are services in which each service is configured to listen and process a specific protocol ... path, and the port, and finally, a call to the CommitChanges method to reflect the changes in the ApplicationHost.config configuration file The result of executing the preceding code can be checked ... additional and advanced settings can be set by right-clicking on the specific application pool and selecting Advanced Settings Classic Mode The Classic mode resembles an IIS 6.0 application pool when...
940
2.7K
2
Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx
Ngày tải lên :
07/03/2014, 10:20
... reaction clearly indicated their lower CD hydrolysis activity In summary, the CD8-imprinted CLIP CGTases had significantly higher catalytic efficiency for CD8 cycliza- tion and lower efficiency ... the immobilized and CD8-imprinted CLIP CGTases with starch can be explained by their changed hydrolytic activities The decreased kcat and overall catalytic efficiency of both CLIP enzymes in the ... maltooligosaccharide to an acceptor sugar molecule in the coupling reaction Furthermore, CGTase can catalyze the hydrolysis of glycosidic linkages in starch [1] The end-products, especially CD6, CD7 and...
10
562
0
Professional ASP.NET 3.5 Security, Membership, and Role Management with C# and VB docx
Ngày tải lên :
15/03/2014, 02:20
... protocols and services that handle request processing inside IIS 7.0 Protocol Listeners Protocol listeners are services in which each service is configured to listen and process a specific protocol ... path, and the port, and finally, a call to the CommitChanges method to reflect the changes in the ApplicationHost.config configuration file The result of executing the preceding code can be checked ... additional and advanced settings can be set by right-clicking on the specific application pool and selecting Advanced Settings Classic Mode The Classic mode resembles an IIS 6.0 application pool when...
940
1.8K
0
Community Genograms Using Individual, Family, and Cultural Narratives with Clients doc
Ngày tải lên :
15/03/2014, 04:20
... method to conceptualize the mediating role of the family across time The dynamics within and among the levels are conceptualized as four concentric circles specifying that cultural, societal, community, ... perspective permits clinicians and clients to access numerous sources of personal and collective strength that can be used to reevaluate the past and effect change in current life tasks and future adaptation ... impact on the meaning-making process and contribute to human development within a specific time and place For example, the abstract concepts of culture and society both inform individual and collective...
177
920
0
Báo cáo khoa học: "Cube Summing, Approximate Inference with Non-Local Features, and Dynamic Programming without Semirings" doc
Ngày tải lên :
17/03/2014, 22:20
... a non- local feature function in G (1, which we call a “function” value) We denote a value u ∈ Acd by u1 , U1 , u2 , U2 , , uk , Uk , gu , us CX,i,k = u ¯ ⊗cd CY,i,j ⊗cd CZ,j,k ⊗cd u (pX→Y Z ⊗cd ... algebraic structure that accommodates it (7) Local features only have access to the most recent deductive proof step (though they may “fire” repeatedly in the proof), while non- local features have access ... To define ⊗cd on a set of operands with N ordinary operands and N function operands, we first compute the full O(k N ) cross-product of the ordinary operands, then apply each of the N functions from...
9
382
0
Owen l astrachan a computer science tapestry exploring programming and computer science with c++ 2nd
Ngày tải lên :
19/03/2014, 14:12
... is with computer science 1.1 What Is Computer Science? In some respects, computer science is a new discipline; it has grown and evolved along with the growth of computing technology and the cheaper, ... Reingold “Calendrical Calculations.” Software-Practice and Experience 20, (September 1990) pp 899–928 [(ed91] Allen B Tucker (ed.) Computing Curricula 1991 Report of the ACM/IEEECS Joint Curriculum ... design with C+ + specifics Chapter Coverage and Dependencies Chapter is an overview of computer science and programming None of the material is used in subsequent chapters, though covering Chapter...
879
489
0
Beginning Mac Programming Develop with Objective-C and Cocoa doc
Ngày tải lên :
22/03/2014, 15:20
... this: Code for House class: accessFoundationSpecifications { generic specification layout and design code here generic foundation code here house-specific code here } Code for ApartmentBlock class: ... The difference isn’t always this clear-cut, but that’s the basic distinction To keep things nice and uncomplicated, we’ll create a basic Cocoa application, so make sure the Cocoa Application template ... accessFoundationSpecifications { generic specification layout and design code here generic foundation code here apartment-block-specific code here } Rather than having this duplicated generic...
417
273
0
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx
Ngày tải lên :
23/03/2014, 09:20
... eukaryotic cytosolic enzymes contain positively charged C- terminal extensions The C- terminal sequence of S cerevisiae and Z mays cytosolic SerRSs is shown in bold letters The sequence truncated ... Sephadex G25 column (Amersham Biosciences, Piscataway, NJ, USA), and precipitated with ethanol The CCA 3¢-end of the tRNASer transcript was reconstituted and labeled with [32P]ATP[aP] by incubation ... 8.3, and 65 mm boric acid) with mm MgCl2 The gel was vacuum-dried for 30 in a gel-dryer, and tRNA was detected by Phosphorimager (Amersham Biosciences) For nonradioactive EMSA, the protein concentration...
12
406
0
Báo cáo khoa học: Structural function of C-terminal amidation of endomorphin Conformational comparison ofl-selective endomorphin-2 with its C-terminal free acid, studied by 1 H-NMR spectroscopy, molecular calculation, and X-ray crystallography pot
Ngày tải lên :
30/03/2014, 20:20
... sulfoxide and TFE) and monocationic form (in water and DPC micelles) for EM2, and zwitterionic form (in dimethyl sulfoxide, TFE, water, DPC micelles) and monocationic form (in acidic water) for ... angles of non- H atoms, and atomic coordinates of H atoms have been deposited in the Cambridge Crystallographic Data Center (CCDC 271791), Cambridge University Chemical Laboratory, Cambridge, ... YR, Chiu TH & Chen CL (1999) Structure-activity relationships of naturally occurring and synthetic opioid tetrapeptides acting on locus coeruleus neurons Eur J Pharmacol 372, 229–236 Gentilucci...
19
314
0
Báo cáo khoa học: "Hierarchical Joint Learning: Improving Joint Parsing and Named Entity Recognition with Non-Jointly Labeled Data" potx
Ngày tải lên :
30/03/2014, 21:20
... stochastic function, and multiple calls to it with the same D and θ will produce different values because D is resampled each time When designing a stochastic objective function, the critical ... (CoNLL), Manchester, UK Charles Sutton and Andrew McCallum 2005 Joint parsing and semantic role labeling In Conference on Natural Language Learning (CoNLL) Kristina Toutanova and Colin Cherry 2009 ... stochastic objective function, which is meant to be a low computational cost estimate of the real objective function In most NLP models, such as logistic regression with a Gaussian prior, computing...
9
336
0
c 48. That jeweler''''s shop was broken into last night and was got .................. with gems doc
Ngày tải lên :
18/06/2014, 17:20
... Pronunciation a supper b hungry c pull d punish c a have b chance c hand d stand b a buck b duck c reduce d structure c a borrow b grow c sparrow d crowd d a leave b weave c weary d steal c ... to before he can walk a creep b crawl c stride d stroll b Test 43 Pronunciation a teacher b headache c chair d cheat b a none b stone c bone d alone a a because b clause c cause d aunt d ... 19 The more careless he is in his work, the more …………… he is a successful b unsuccessful c unsuccess d success b 20 The conductor often collects the bus a fares b tariffs c prices d fees a...
43
371
0
Báo cáo hóa học: " Motor unit potential morphology differences in individuals with non-specific arm pain and lateral epicondylitis" pptx
Ngày tải lên :
19/06/2014, 08:20
... muscle changes unrelated to static work load Chemical and morphologic controlled studies of 22 women with and without neck pain Acta Orthop Scand 1992, 63:203-206 Hagg G: Static workloads and occupational ... process and over the dorsum of the hand of the test limb was cleaned with rubbing alcohol prior to electrode placement A surface AgAgCl electrode (Kendall-LTP, Chicopee, Massachusetts) was cut ... A: Load pattern and pressure pain threshold in the upper trapezius muscle and psychosocial factors in medical secretaries with and without shoulder/neck disorders Int Arch Occup Environ Health...
11
699
0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt
Ngày tải lên :
20/06/2014, 01:20
... genomic segments of C/ JHB/1/66 virus Segment 3' end non coding sequencea PB2 PB1 P3 HEF NP M NS UCGUCUUCGUCUCCUAACCUU(UAC) UCGUCUUCGUCUCCUAA(UAC) UCGUCUUCGUCCCCUAGGCUU(UAC) UCGUCUUCGUCCCCCAAUUAU(UAC) ... UCGUCUUCGUCCCCCAAUUAU(UAC) UCGUCUUCGUCCUCUAAACCAAAAGUUUU(UAC) UCGUCUUCGUCCCCUGAAAAUUUGU(UAC) UCGUCUUCGUCCCCAUGAAAAAGUUU(UAC) PB2 PB1 P3 HEF NP M NSb a in 5' end non coding sequencea AGCAGUAGCAAGAGGAUUU(UUA) AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG ... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA...
11
427
0
báo cáo hóa học:" Research Article A Mixed Problem for Quasilinear Impulsive Hyperbolic Equations with Non Stationary Boundary and Transmission Conditions" ppt
Ngày tải lên :
21/06/2014, 11:20
... algebraic equations: √ c1 2 e− a2 −a1 λ c1 1 λ ci1 e− √ −ai λ − pi ci1 e− 1 −ai λ cm1 e− am ci t √ 1,1 −am , c1 1 − c1 2 e− a2 −a1 − ci2 qi t λ pi t ci1 e− ci − −ai 1,2 e √ λ/pm t 1,1 − ci λ/pi 1,2 ... Differential-Operator Equations Ordinary and Partial Differential Equations, vol 103 of Chapman & Hall/CRC Monographs and Surveys in Pure and Applied Mathematics, Chapman & Hall/CRC, Boca Raton, Fla, USA, 2000 ... modern technology, where impulsive automatic control systems and impulsive computing systems are very important and intensively develop broadening the scope of their applications in technical problems,...
19
306
0
Xem thêm