0

cleaning house in a networked environment

Tài liệu Debugging C and C++ code in a Unix environment ppt

Tài liệu Debugging C and C++ code in a Unix environment ppt

Kỹ thuật lập trình

... cafetaria and some serious caffeine and sugar intake while reading (and annotating) your code carefully Tools In this section a number of tools relating to debugging and analysing your programs ... there are several formats for documentation in common use Manual pages Online manual pages (‘man-pages’) are the traditional format for documentation under Unix Man-pages are almost always reference ... assert macro, your program will be aborted as soon as an assertion fails, and you will get a message stating that the assertion expression failed at line l of file f assert is a macro; you can...
  • 29
  • 466
  • 1
Intellectual Property and Traditional Cultural Expressions in a Digital Environment pptx

Intellectual Property and Traditional Cultural Expressions in a Digital Environment pptx

Cao đẳng - Đại học

... behind relying on national patent law is revealed by the Ayahuasca Liana case, where da Vine was only patentable because of its slightly modified petal and leaf shape But also approaches relying ... example, environmental rationality against trade rationality, human rights rationality against the rationality of diplomatic intercourse Thus described, fragmentation of international law would articulate ... Press, 2004, at p 107 25 Beatriz Caiuby Labate and Wladimyr Sena Araujo, O Uso Ritual da Ayahuasca, Campinas: Mercado de Letras, 2004; Carsten Balzer, Wege zum Heil: Die Barquinha Eine ethnologische...
  • 344
  • 641
  • 1
Intellectual Property Rights in a Networked World: Theory and Practice doc

Intellectual Property Rights in a Networked World: Theory and Practice doc

Cao đẳng - Đại học

... bookstore that had also used the “Amazon” name Initially, one would assume that Amazon.com would have a good case for registering “Amazon” both as a trademark and a domain name Before the Amazon.com ... Controversies Involving Internet Domain Names One particularly contentious issue concerning trademark disputes in cyberspace has involved the registering of Internet domain names A domain name is an alphanumeric ... narrates a tale about marriage and love in early 19th Century England, this “discourse” has distinct qualities thanks to her intentional use of language in a certain way and with a certain style...
  • 303
  • 1,106
  • 1
Analytical Chemistry in a GMP Environment: A Practical Guide pot

Analytical Chemistry in a GMP Environment: A Practical Guide pot

Hóa học - Dầu khí

... SAMPLE HANDLING AND PREPARATION 11.1 Analytical tests may be required for a variety of reasons, including establishing an average analyte value across a material, establishing an analyte concentration ... LGC, UK; Bernard King, NARL, Australia; Alan Squirrell, NATA, Australia and Maire Walsh, State Laboratory, Ireland In addition, over the years leading to the drafting of this and earlier versions ... profile across a material, or determining local contamination in a material In some cases, for example forensic analysis, it may be appropriate to examine the entire material In others, it is appropriate...
  • 57
  • 685
  • 1
Intellectual Property Rights In A Networked World: Theory And Practice doc

Intellectual Property Rights In A Networked World: Theory And Practice doc

Cao đẳng - Đại học

... bookstore that had also used the “Amazon” name Initially, one would assume that Amazon.com would have a good case for registering “Amazon” both as a trademark and a domain name Before the Amazon.com ... Controversies Involving Internet Domain Names One particularly contentious issue concerning trademark disputes in cyberspace has involved the registering of Internet domain names A domain name is an alphanumeric ... narrates a tale about marriage and love in early 19th Century England, this “discourse” has distinct qualities thanks to her intentional use of language in a certain way and with a certain style...
  • 303
  • 511
  • 0
Protecting Children''''s Health In A Changing Environment - Report Of The Fifth Ministerial Conference On Environment And Health.pdf potx

Protecting Children''''s Health In A Changing Environment - Report Of The Fifth Ministerial Conference On Environment And Health.pdf potx

Sức khỏe giới tính

... Ministerial Conference A range of environmental risk factors threatens health: inadequate water and sanitation, unsafe home and recreational environments, lack of spatial planning for physical ... Protecting children’s health in a changing environment Role of international financing mechanisms Climate change is a great challenge and a threat to health, but also an opportunity Structural transformation ... implementation; • scaling up existing financial mechanisms; • bringing in new and innovative sources of finance; and • building capacities to secure, absorb and deploy environmental financing The...
  • 92
  • 501
  • 0
BOREAL SHIELD WATERSHEDS Lake Trout Ecosystems in a Changing Environment ppt

BOREAL SHIELD WATERSHEDS Lake Trout Ecosystems in a Changing Environment ppt

Điện - Điện tử

... Resources Canada, Ottawa Ecological Stratification Working Group, 1995, A National Framework for Canada Cat No A4 2–65/1996E, Agriculture and Agri-Food Canada and Environment Canada, Ottawa Fulton, ... (Picea glauca), balsam fir (Abies balsamea), and eastern white pine (Pinus strobes) Throughout the area, warmer and drier sites are dominated by jack pine (Pinus banksiana) and red pine (Pinus resinosa); ... Dauphin, and Winnipegosis In addition to these Manitoban areas, at various stages of its life Lake Agassiz also extended well into Ontario and Saskatchewan in Canada and the northern parts of the states...
  • 528
  • 479
  • 0
Arctic Alpine Ecosystems and People in a Changing Environment pdf

Arctic Alpine Ecosystems and People in a Changing Environment pdf

Điện - Điện tử

... central Arctic have warmed by 0.5°C), temperatures in Canada’s Hudson Bay and in Greenland, particularly in the Davis Strait area have decreased (Chapman and Walsh 1993), suggesting that climate ... Nordic Arctic Research Programme National Aeronautics and Space Administration, USA Indian and Northern Affair’s, Northern Contaminants Program Normalised Difference Vegetation Index National Environmental ... photosynthetic active radiation (PAR) may also cause a suite of cellular damages (Hessen Chap 13) Vincent et al (Chap 14) show that arctic, antarctic and alpine aquatic ecosystems are particularly vulnerable...
  • 446
  • 451
  • 0
PROVIDING HIV/AIDS CARE IN A CHANGING ENVIRONMENT pdf

PROVIDING HIV/AIDS CARE IN A CHANGING ENVIRONMENT pdf

Sức khỏe phụ nữ

... within the past months, especially “family financial problems, parental abuse of alcohol, parental arguing and fighting, changing schools, serious accidents, and death in the family.”22 Because ... counseling and testing HIV/AIDS stigma and fear of the lifethreatening implications of an HIV diagnosis—as well as a lack of awareness of “teen-friendly” testing facilities—may 0 The Family Advocacy ... Health and Human Services Health Resources and Services Administration HIV/AIDS Bureau Editor Richard Seaton Impact Marketing and Communications All information herein is in the public domain...
  • 8
  • 369
  • 0
Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

Báo cáo khoa học

... kb DNA fragment, containing the sequence encoding the ectodomain of gp41 of HIV isolate LAI (amino acids 537–669), was obtained by PCR amplification using, as template, a plasmid containing the ... 5¢-CTCTTTCATGACGCTGACGGTA CAGGCC-3¢; reverse primer: 5¢-CCGCTCGAGCTAATG GTGATGGTGATGGTGTGACCCTCCCCCTCCACT TGCCCATTTATCTAA-3¢ The start codon in the forward primer (in bold) is a naturally occurring ... urea, 500 mM NaCl, 10 mM imidazole, pH 8.0) and agitated at °C for 30 After filtration using a 0.45 lm cut-off filter, protein was loaded onto a ml Hi-Trap Chelating column (Amersham Pharmacia Biotech),...
  • 14
  • 375
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "RESPONDING TO USER QUERIES IN A COLLABORATIVE ENVIRONMENT*" docx

Báo cáo khoa học

... Sandra Carberry A meta-rule approach to flexible plan recognition in dialogue User Modeling with a variable This variable may be instantiated by the and User-Adapted lnteraction, 2:27 53, 1992 Insert-Correction ... expectations: Computing expert responses In Several researchers have studied collaboration [1, 3, 10] Proc AAAL pages 169 175, 1984 [6] Lynn Lambert and Sandra Carberry A tripartite plan-based and Allen proposed ... as long as the course is a seminar course, the system genIn Darpa Speech and Natural Language Workshop, 1991 eralizes the user's proposed action by replacing CS689 [2] Rhonda Eller and Sandra...
  • 3
  • 352
  • 0
Lesson 2 Working with data in a connected environment

Lesson 2 Working with data in a connected environment

Cao đẳng - Đại học

... Connected environment Windows Database Connection Command DataReader Form Slide Features of DataReader  A type that is good for reading data in the most efficient manner possible  Read-only, forward-only ... Load only a single row into memory at a time  Only one DataReader use at a time  Tie to connection => cannot used other DataReader  Explicitly close DataReader after used  DataReader cannot ... sequentially read data from a data source  The return results of Command SQL statements (no constructor)  How to use DataReader with data providers?  How to retrieving data using a DataReader?...
  • 21
  • 302
  • 0
Chapter 6 Working with Data in a Connected Environment

Chapter 6 Working with Data in a Connected Environment

Cao đẳng - Đại học

... SQL Maintain data DataSet Get data Command Object Maintain data Get data Connection Object DataAdapter Provider Database VB.Net 2005 - Chapter 6 Main Difference:DataSet-DataReader DataSet Data structure ... demand on client memory and CPU System.Data Architecture Program DataReader DataSet DataProvider DataAdapter Database VB.Net 2005 - Chapter Details: System.Data Architecture Program DataReader Action ... Commandn Commandn Which data? DataReadern DataReadern Result 23 VB.Net 2005 - Chapter DataReader Class Datareader and MS Access Store the information obtained by the command In stateless stream...
  • 27
  • 259
  • 0
Chapter 7 Create, Add, Delete, and Edit Data in a Disconnected Environment

Chapter 7 Create, Add, Delete, and Edit Data in a Disconnected Environment

Cao đẳng - Đại học

... own DataSet (schema) 1 Create Dataset Add DataTable(s) Add DataColumn(s) to DataTable Define datatable schema Fill Data into DataTable(s) in DataSet 2 Add DataRow to DataTable Processing data in ... provides access to one row of data in a DataTable DataSet A DataTable's DataRow objects contain all the data in the DataTable Create DataTable DataColumn DataRow Table.NewRow method Can access DataRow ... Objectives in chapter Create a DataSet graphically Create a DataSet programmatically Add a DataTable to a DataSet Add a relationship between tables within a DataSet Navigate a relationship between tables...
  • 50
  • 383
  • 0
báo cáo hóa học:

báo cáo hóa học: " A kinematic analysis of a haptic handheld stylus in a virtual environment: a study in healthy subjects" pptx

Hóa học - Dầu khí

... collaboration We also thank Hans Aniansson for carrying out the neuropsychological examinations, Sara and Lisa Broeren for drawing velocity and acceleration profiles and Ragnar Pascher for programming ... straight line distance required to obtain a hand path ratio (HPR) Thus, a hand trajectory that followed a straight line pathway to the target would have an HPR equal to 1, whereas a hand trajectory ... sessions and All participants were tested between 10 AM and PM All tests were performed with the right hand Data analysis Kinematic data sampling and information processing Hand position data (haptic...
  • 8
  • 551
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Blind recovery of k/n rate convolutional encoders in a noisy environment" pdf

Hóa học - Dầu khí

... algorithm-based approach was developed and applied to the case of a rate 1/2 convolutional encoder [13] At nearly the same time, a probabilistic algorithm based on the Expectation Maximization (EM) algorithm ... http://jwcn.eurasipjournals.com/content/2011/1/168 parameters can be realized by solving the system described in Property In [15,17], a similar approach, based on a rank calculation, is used to identify the size of an interleaver In this article, ... encoders used take typically quite very small values Indeed, the maximum parameters are such that nmax = 5, kmax = 4, Kmax = 10 (30) A minimum value of lmax is given in Table for three optimal encoders...
  • 9
  • 495
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Implementation of a Cooperative MAC Protocol: Performance and Challenges in a Real Environment" doc

Hóa học - Dầu khí

... corresponding data packet, since such information is contained in the MAC header and is in many instances transmitted at a rate higher than what STAs can support Fortunately, since each data packet sometimes ... physical layer header (PLCP header) of any 802.11 data packet has rate information in its PLCP signaling field Since PLCP header is always transmitted at the base rate, it can be decoded and understood ... establishment and maintenance of a special data structure called the cooperation table (a. k .a CoopTable) as shown in Figure 3, which contains essential information related to all the potential...
  • 19
  • 367
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Measurement Combination for Acoustic Source Localization in a Room Environment" ppt

Hóa học - Dầu khí

... source In contrast, MAP and median SIMULATION AND RECORDING SETUP A dialogue situation between talkers is analyzed The localization methods already discussed are compared using simulations and real-data ... and the transition range in between) in TDOA estimation accuracy have been identified in a nonreverberant environment [6] In the high SNR range, the TDOA variance attains the Cramer-Rao lower bound ... Even a moderate increase in the reverberation time may cause dominant noise peaks [7], leading to the failure of the traditional localization approach [15] Recently, particle filtering (PF)-based...
  • 14
  • 298
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Research Article A Robust Statistical-Based Speaker’s Location Detection Algorithm in a Vehicular Environment" pptx

Báo cáo khoa học

... threshold-based location detection approach that utilizes the training signals and the trained GM location model parameters to determine a suitable length of testing sequence and then obtain a threshold ... microphone pairs may not be statistically independent of each other, GMMs with diagonal covariance matrices have been observed to be capable of modeling the correlations within the data by increasing ... Liu, and T M Su, A speaker tracking system with distance estimation using microphone array,” in Proceedings of the IEEE/ASME International Conference on Advanced Manufacturing Technologies and...
  • 11
  • 264
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25