... Cobb LA: Health status of survivors of cardiac arrest and of myocardial infarction Am J Pub Health 1985, 75:1321-1323 Agarwal M, Dalal AK, Agarwal DK, Agarwal RK: Positive life orientation and ... http://www.hqlo.com/content/3/1/80 Table 1: Demographic and clinical characteristics of diabetic patients and non-diabetic patients at baseline hospitalization Diabetic N = 96 Demographic characteristics Males Mean age (years) ... Procedures at baseline Angiography Angioplasty Bypass surgery Revascularization Time to angiography (median days) Characteristics of angiography Diseased coronary vessels None One Two Three Left main...
Ngày tải lên: 20/06/2014, 15:20
... disappearance of all tumor masses confirmed at clinical examination, or X-rays, and ultrasound studies; a normal BM examination and pathology; and no evidence of CNS disease by cerebrospinal ... Eguchi M, Tanaka K, Hamamoto K, Ohki M, Ueda K, Kamada N: Fluorescence in situ hybridization analysis of 12;21 translocation in Japanese childhood acute lymphoblastic leukemia Jpn J Cancer Res ... pediatric ALL and defines a subgroup of patients with an excellent prognosis Leukemia 1995, 9(12):985-989 Satake N, Sakashita A, Kobayashi H, Maseki N, Sakurai M, Kaneko Yl: Minimal residual disease with...
Ngày tải lên: 10/08/2014, 22:20
báo cáo khoa học: "A homoharringtonine-based induction regimen for the treatment of elderly patients with acute myeloid leukemia: a single center experience from China" pptx
... Coso D, Bardou VJ, Stoppa AM, Braud AC, Bouabdallah R, Sainty D, Mozziconacci MJ, Lafage M, Damaj G, Blaise D, Gastaut JA, Maraninchi D: The benefit of induction chemotherapy in patients age > or ... years Cancer 2004, 101:325-331 Alymara V, Tzouvara E, Vartholomatos G, Chaidos A, Tsiara S, Bourantas KL: A single-center, retrospective study of management Page of (page number not for citation ... Characteristics of the patients Characteristics of the patients at the time of diagnosis are listed in Table The median age of these patients was 70 (60–84) years Seven patients had history of...
Ngày tải lên: 10/08/2014, 22:20
báo cáo khoa học: "Pharmacokinetic targeting of intravenous busulfan reduces conditioning regimen related toxicity following allogeneic hematopoietic cell transplantation for acute myelogenous leukemia" potx
... busulfan and cyclophosphamide, we aimed to confirm these observations in a comparative analysis of outcomes of AML patients Methods Patients All consecutive acute myelogenous leukemia (AML) patients ... data, analyzed data, and wrote the manuscript; JK contributed to data analysis; CA contributed to design of project, analysis, and critical review of manuscript; MKD contributed to analysis and ... Author details Department of Blood and Marrow Transplantation, Moffitt Cancer Center, 12902 Magnolia Drive, Tampa, FL, 33612, USA 2Department of Biostatistics, Moffitt Cancer Center, 12902 Magnolia...
Ngày tải lên: 10/08/2014, 22:21
Báo cáo hóa học: " Research Article Simultaneous versus Nonsimultaneous Blowup for a System of Heat Equations Coupled Boundary Flux" pptx
... up at T, while u remains bounded up to that time for every pair of initial data Proof of main results Without loss of generality, we consider the case p11 > p21 , to show that there exists a pair ... solution of the heat equation with a nonlinear boundary condition,” Transactions of the American Mathematical Society, vol 346, no 1, pp 117–135, 1994 [9] G M Lieberman, Second Order Parabolic ... C Br¨ ndle, F Quiros, and J D Rossi, “Non-simultaneous blow-up for a quasilinear parabolic a system with reaction at the boundary,” Communications on Pure and Applied Analysis, vol 4, no 3, pp...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo sinh học: "Physical forces in myelination and repair: a question of balance" potx
... unbalancing the cellular forces and inhibiting remyelination The main implications of the findings of Simons and colleagues [5] are, therefore, that a particular balance of extracellular adhesion, ... fails, for as-yet unknown reasons An implication of the results of Simons and colleagues [5] is that increased rigidity in the scarred brain may play a role by unbalancing the intracellular and ... require a balance between extracellular forces mediated by matrix rigidity and intracellular forces based on actomyosin contractions (diagonal arrow) A softer matrix inhibits cell differentiation and...
Ngày tải lên: 06/08/2014, 19:21
báo cáo khoa học: "Ring chromosome 18 abnormality in acute myelogenous leukemia: the clinical dilemma" ppt
... al: Flow cytometric analysis of acute leukemias Diagnostic utility and critical analysis of data Arch Pathol Lab Med 2003, 127(1):42-8 Byrd JC, et al: Pretreatment cytogenetic abnormalities are ... et al: Loss of genetic material is more common than gain in acute myeloid leukemia with complex aberrant karyotype: a detailed analysis of 125 cases using conventional chromosome analysis and ... mutations and expression changes, and prognosis in adult acute myeloid leukemia Hematology Am Soc Hematol Educ Program 2006, 169-77 Dohner H, et al: Diagnosis and management of acute myeloid leukemia...
Ngày tải lên: 10/08/2014, 22:21
báo cáo khoa học: "Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic myeloid leukemia" pot
... (upstream) 5’-GGAGCTGCAGATGCTGACCAAC-3’ CML (downstream) 5’-TCAGACCCTGAGGCTCAAAGTC-3’ CML (upstream) 5’-CGCATGTTCCGGGACAAAAGC-3’ Results Genetic feature of the CML case Clinical, cytogenetic and ... Patton WN: Clonally unrelated BCR-ABL-negative acute myeloblastic leukemia masquerading as blast crisis after busulphan and interferon therapy for BCR-ABL-positive chronic myeloid leukemia Leukemia ... polymerase chain reaction (RT-PCR) and the genescan analysis to assay for TCR Va and Vb gene utilization and clonal expansion in a patient who developed Ph-negative acute lymphoblastic leukemia while...
Ngày tải lên: 10/08/2014, 22:21
Báo cáo y học: " Improvement of platelet dysfunction in chronic myelogenous leukemia following treatment with imatinib: a case report" pps
... MvBB analyzed and interpreted the patient data regarding the hematological disease and contributed to the writing and revision of the manuscript All authors read and approved the final manuscript ... tomography revealed a large hematoma in the left gluteal region One day after the onset of symptoms surgery became necessary because of increasing swelling accompanied by a drop of the hemoglobin and ... increased megakaryopoeisis [8] Also, Thiele et al [9] found that the atypical micromegakaryocytes that are prevalent in Ph+ CML were significantly reduced after imatinib therapy with a further reappearance...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo hóa học: " A new electromechanical trainer for sensorimotor rehabilitation of paralysed fingers: A case series in chronic and acute stroke patients" pdf
... design & analysis of the study and the preparation of the manuscript All authors reviewed the final manuscript Additional material Additional file Table 1: Clinical data of both groups at study ... sense All patients were already participating in a comprehensive in-patient rehabilitation programme including 45 of physiotherapy and 30 of occupational therapy every workday The major treatment ... benefit of passive movements, active movements lead to greater cortical and muscle activation Lotze et al measured changes in activa- Page of (page number not for citation purposes) Journal of NeuroEngineering...
Ngày tải lên: 19/06/2014, 08:20
báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx
... PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgttgaaacaaatggc PCR-RFLP (HaeIII) Leptin receptor gene - Q223R aaactcaacgacactctcctt tgaactgacattagaggtgac PCR-RFLP ... 14 Radwanska U, Michalewska D, Armata J, Balwierz W, BoguslawskaJaworska J, Cyklis R, Derulska D, Kolecki P, Lastowska M, Newecka-Samol T: Acute lymphoblastic leukemia therapy in Poland A report ... GB, Fink AA, Weder AB, Cooper RS, Galan P, Chakravarti A, Schlessinger D, Cao A, Lakatta E, Abecasis GR: Genome-wide association scan shows genetic variants in the FTO gene are associated with...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: "Acute myeloid leukemia of donor origin after allogeneic stem cell transplantation from a sibling who harbors germline XPD and XRCC3 homozygous polymorphisms" pps
... cancer: an overview of the randomised trials Early Breast Cancer Trialists’ Collaborative Group Lancet 1998, 352:930-942 Srivastava A, Murari M, Datta NR: Early occurrence of acute myeloid leukemia ... USA 2001, 98:11592-11597 Naoe T, Takeyama K, Yokozawa T, Kiyoi H, Seto M, Uike N, Ino T, Utsunomiya A, Maruta A, Jin-nai I, Kamada N, Kubota Y, Nakamura H, Shimazaki C, Horiike S, Kodera Y, Saito ... DeCillis A, Anderson S: Acute myeloid leukemia and myelodysplastic syndrome after doxorubicin- cyclophosphamide adjuvant therapy for operable breast cancer: The national surgical adjuvant breast and...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "A meta-analysis of CAG (cytarabine, aclarubicin, G-CSF) regimen for the treatment of 1029 patients with acute myeloid leukemia and myelodysplastic syndrome" ppsx
... Data source The databases of PubMed, Wanfang Data, as well as American Society of Hematology (ASH) and American Society of Clinical Oncology (ASCO) annual meeting abstracts were searched for articles ... Saito K, Nakamura Y, Aoyagi M, Waga K, Yamamoto K, Aoyagi A, Inoue F, Arai Y, Tadokoro J, Handa T et al: Low-dose cytarabine and aclarubicin in combination with granulocyte 18 colony-stimulating ... Furusawa S, Saito K, Waga K, Koike T, Arimura H, Aoyagi A, Yamato H, Sakuma H, Tsunogake S et al: Concurrent use of granulocyte colony-stimulating factor with lowdose cytosine arabinoside and aclarubicin...
Ngày tải lên: 10/08/2014, 21:23
báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx
... anti-RNP antibody, and anti-SS -A antibody Bilateral hand X-rays showed mild swelling and destruction of the metacarpo-phalangeal (MP) and proximal-inter-phalangeal (PIP) joints He was diagnosed to have ... Hoshida Y, Xu JX, Fujita S, Nakamichi I, Ikeda J, Tomita Y, Nakatsuka S, Tamaru J, Iizuka A, Takeuchi T, Aozasa K: Lymphoproliferative disorders in rheumatoid arthritis: clinicopathological analysis ... (Figure 1A) , and a diagnosis of AML-MLD was made based on World Health Organization (WHO) criteria [4] The immunophenotype of blasts was CD7, 13, 33, 34, and HLA-DR positive, and an abnormal karyotype,...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo y học: " Failure of a non-authorized copy product to maintain response achieved with imatinib in a patient with chronic phase chronic myeloid leukemia: a case report" ppsx
... consisting of the alpha crystal form of imatinib, has become commercially available under the name ‘imatib’ (CIPLA-India) at a markedly reduced price The lower price has prompted some health-care authorities ... %BCR-ABL/ABL International Scale (IS) score of about 0.01 compared to an initial value of This status had been maintained for approximately three years In January 2007, his BCR-ABL scored negative by nested ... International Randomized Trial of Interferon versus STI571 (IRIS), responses to first-line imatinib have been remarkably durable [2] Estimated annual rates of treatment failure after the start of...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " Spontaneous regression of Merkel cell carcinoma in a patient with chronic lymphocytic leukemia: a case report" pps
... immunohistochemical examination and participated in writing of the manuscript All authors read and approved the final manuscript Acknowledgements All the authors are grateful to Professor Ðuro Vranesic for carrying ... specimens showed an abundance of relatively monomorphic, atypical, epithelial-appearing cells without Figure Clinical presentation of tumor (A) 70-year-old Caucasian woman with a rapidly growing ... which is associated with an increased incidence of cutaneous malignancies The patient was discharged from hospital days after the surgery and was referred to local radiotherapy She was readmitted...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo khoa học: "A comparison of admission and worst 24-hour Acute Physiology and Chronic Health Evaluation II scores in predicting hospital mortality: a retrospective cohort study" ppsx
... was mandatory in the APACHE data recording form If the patient was anaesthetised before ICU admission, the Glasgow coma score was assessed using the available clinical information prior to anaesthesia ... The calibration curve of the two The use of the admission APACHE II score to calculate the APACHE II predicted mortality (admission APACHE II model) has a few potential advantages and may represent ... parentheses are standard deviations unless stated otherwise APACHE, Acute Physiology and Chronic Health Evaluation; ICU, intensive care unit; SD, standard deviation Page of (page number not for citation...
Ngày tải lên: 12/08/2014, 23:20
Báo cáo y học: "Endothelial A comparison of early versus late initiation of renal replacement therapy in critically ill patients with acute kidney injury: a systematic review and meta-analysis" pdf
... extracted data, performed statistical analysis and tabulated quality indicators of the studies IS and SM carried out the primary study search and extracted data AL carried out statistical analysis and ... Ceylan S, Arslan M, Vural A, Tatar H: Timing of replacement therapy for acute renal failure after cardiac surgery J Card Surg 2004, 19:17-20 Elahi M, Asopa S, Pflueger A, Hakim N, Matata B: Acute ... meta-analyses Additional File 2: Summary of search strategy Detailed summary of search terms and strategy used for systematic literature search Abbreviations AKI: acute kidney injury; AKIN: Acute...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"
... Renal Data System USRDS 2003 annual data report: atlas of end-stage renal disease in the United States Bethesda: National Institutes of Health, National Institute of Diabetes and Digestive and Kidney ... composite marker which reflects malnutrition as well as increased acute phase inflammation, considering that albumin is also a negative acute phase reactant (38, 42-45) Our study has several limitations ... intervals All analyses were conducted with the use of STATVIEW software RESULTS The patients included 52% male and 48% female, 85% white and 15% black and mean age was 57 years The majority of patients...
Ngày tải lên: 03/11/2012, 11:52
A STUDY OF LINGUISTIC FEATURES OF THE NAMES OF COFFEE SHOPS IN ENGLISH VERSUS VIETNAMESE
... Reduplication A total reduplication also appears in Vietnamese names of coffee shops as variants of some names They are made based on the repetition of the name sound and their meaning shades are ... the patriotic appeal Finally, distant geographic names can be used to create an exotic image For examples include, American Airlines, Asian Paints, Air India etc Alpha – numeric brand names: ... Names of Coffee Shops in Vietnamese According to Wikipedia, Vietnamese, like many languages in South East Asia, is an analytic (or isolating) language Vietnamese lacks morphological marking of case,...
Ngày tải lên: 26/11/2013, 12:41