choose what music to play—via a screen saver
Báo cáo khoa học: "What do we know about medication errors made via a CPOE system versus those made via handwritten orders"
Ngày tải lên :
25/10/2012, 10:39
... physicians Also, the CPOE Shulman et al [1] examined included an available (but not interactive) on-line information system with drug interactions, contraindications, side effects, formulary, and IV administration ... Berger and Kichak [3] make the critical point that studies of prescribing errors overwhelmingly count errors that not affect patients We almost always count potential errors, not actual adverse ... consider that among CPOE systems’ many virtues is their ability to reduce errors that seldom reach patients (which neither negates their many valuable contributions nor precludes their extraordinary...
- 2
- 524
- 1
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
Ngày tải lên :
16/02/2014, 09:20
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC ... GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298 PAI-2) Reverse (nt 1860–1843 PAI-2) Forward (nt 1491–1508 PAI-2) Reverse...
- 14
- 635
- 0
Tài liệu What to do after a death in England or Wales pptx
Ngày tải lên :
16/02/2014, 10:20
... straight away, as the price increases if you need one later on The registrar may not be able to give you all the copies straight away and may ask you to call back or ask you to pay an amount towards ... to 21 Arranging the funeral without a funeral director Many people choose to use a professional funeral director to organise a funeral They this partly because it is easier, at what is generally ... certificate if a coroner has issued a certificate for cremation or an order for burial Arranging a cremation If a person died abroad and you have brought their body back to England or Wales to arrange...
- 74
- 342
- 0
Báo cáo khoa học: Ras oncogene induces b-galactoside a2,6-sialyltransferase (ST6Gal I) via a RalGEF-mediated signal to its housekeeping promoter pptx
Ngày tải lên :
16/03/2014, 18:20
... H-Ras and K-Ras were as described [36] H-Ras exon sense: 5¢-CTGAG GAGCGATGACGGAAT-3¢, H-Ras exon antisense: 5¢-ACACACACAGGAAGCCCTCC-3¢, K-Ras exon sense: 5¢-CCTGCTGAAAATGACTGAAT-3¢, K-Ras exon antisense: ... N-linked to asparagine: enzymatic characterization of a Galb1,3(4)GlcNAc :a2 ,3-sialyltransferase and a Gal b1,4GlcNAc :a2 ,6–sialyltransferase from rat liver J Biol Chem 257, 13845–13853 25 Takashima, ... (5¢-GGATGGCACCGGCAGACATG-3¢) and mst171 (5¢-CACAGAAATGGGATCAGGCC-3¢) Both human H-Ras and K-Ras cDNA were obtained from Cancer Research UK Human H-Ras cDNA probe was isolated from an EcoRI digestion of H-RasV12...
- 12
- 369
- 0
Learning to play games or playing games to learn? A health education case study with Soweto teenagers pptx
Ngày tải lên :
22/03/2014, 15:21
... both as an analytical frame to design educational games and as a means to understand tool-mediated knowledge construction through game play Cultural Historical Activity Theory CHAT originated ... the learning task For example I was learning about cancer and Hiv & Aids and I like the game because it teaches about aids, cancer and malaria that those things killers and that shows us that our ... to the use of games in the classroom, it was argued that games are mostly used as tutors, a learning from position rather than as tools to mediate learning, a learning with position When a game...
- 20
- 452
- 0
Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx
Ngày tải lên :
24/03/2014, 03:20
... could enable agents to emulate many elements of more natural and realistic human conversational behavior A computational model may also make valuable contributions to research in the area of computer-mediated ... the task paradigm used to collect the data for our corpus evaluation We describe the basic experimental paradigm and detail how it can be used to examine the impact of various features of a shared ... models to a new task domain that can elaborate on referential patterns in the presence of various forms of shared visual information Finally, we make use of a corpus gathered from laboratory studies...
- 8
- 567
- 0
amacom, what every new manager needs to know - making a successful transition to management
Ngày tải lên :
08/05/2014, 09:42
... AMACOM books are available to corporations, professional associations, and other organizations For details, contact Special Sales Department, AMACOM, a division of American Management Association, ... hats that managers wear, the expectations that go with them, how the expectations change as the occasion demands, and how managers develop an appropriate balance THE ADMINISTRATION HAT: MANAGING ... management basics and human behavior supplemented with complementary attitudes, certain personal characteristics, and relevant experience The day -to- day leadership of an organization takes place...
- 256
- 356
- 0
![teaching music to students with special needs [electronic resource] a label free approach](https://media.store123doc.com/images/document/14/y/pj/medium_pju1401474515.jpg)
teaching music to students with special needs [electronic resource] a label free approach
Ngày tải lên :
31/05/2014, 01:28
... often, music educators adapt teaching to accommodate students who learn at a slower rate; however, it is important to also consider adapting our teaching for those students who learn at a faster rate ... special education system Chapter is intended for all music educators and music teacher educators to increase the knowledge and understandings of music educators as they plan, implement, and advocate ... City Nairobi New Delhi Shanghai Taipei Toronto With offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland...
- 261
- 711
- 0
Báo cáo hóa học: " Homologous recombination is unlikely to play a major role in influenza B virus evolution" doc
Ngày tải lên :
20/06/2014, 01:20
... shifts for each of the recombinants have strong bootstrap support (data not shown) However, large influenza viral genes in the databases may actually represent assembled artifactual contigs from ... were derived by plaque purification Furthermore, the same laboratory was the source for all four recombinants and the one putative parental strain As suggested in influenza A virus [9], further ... viruses was very rare or absent and could not confer a substantial fitness advantage Therefore, we conclude that homologous recombination is unlikely to play a major role in influenza B virus...
- 3
- 282
- 0
Báo cáo khoa học: "Does the surgeon still have a role to play in the diagnosis and management of lymphomas?" docx
Ngày tải lên :
09/08/2014, 07:21
... 1: Anatomical location of lymphomatous lymph nodes (n = 62) Anatomical location Number of cases Cervical Inguinal Axillary Intra-abdominal Supraclavicular Submandibular Parotid Peri-orbital Mediastinal ... relates to the fact that, for those patients found to have squamous carcinoma metastases from a head and neck primary, open biopsy leads to a significantly higher local treatment failure rate ... to allow accurate cellular classification of the lymphomas Fine needle aspiration cytology (FNAC) was developed at the turn of the century and has become a popular diagnostic tool as it is rapid,...
- 4
- 435
- 0
Báo cáo khoa hoc:" A quasi-score approach to the analysis of ordered categorical data via a mixed heteroskedastic threshold model" pdf
Ngày tải lên :
09/08/2014, 18:21
... Marginal likelihood and Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian models, Comput Stat Data Anal 13 (1992) 291-305 [15] Foulley J.L., Quaas ... variance-covariance matrix of data by a Taylor expansion about small intra-class correlations Moreover, as pointed out by Knuiman and Laird !27!, u solutions to equation (26) have no clear justification An ... to be a natural alternative to the MAP approach proposed by Foulley and Gianola !8! The main advantage of the MAP approach lies in both its conceptual and computational simplicity Part of this...
- 18
- 297
- 0
báo cáo khoa học: " What are possible barriers and facilitators to implementation of a Participatory Ergonomics programme?" docx
Ngày tải lên :
10/08/2014, 10:23
... data extracted, a qualitative software program (Atlas.ti version 5.2) was used to electronically code and manage data, and to generate reports of coded text for analysis To illustrate the meaning ... a barrier and a facilitator Most factors (n = 5) for implementation were found at the level of the ergonomic measure Organisational level At the organisational level, three factors appeared to ... made and approved before the working group meeting took place (f) b + f: explanation could be both a barrier and a facilitator b: explanation of a barrier f: explanation of a facilitator Table presents...
- 9
- 293
- 0
Báo cáo y học: " Pro/Con Debate: Does recombinant factor VIIa have a role to play in the treatment of patients with acute nontraumatic hemorrhage" ppt
Ngày tải lên :
12/08/2014, 23:24
... Administration MedWatch database [10] described 151 complications associated with off-label use of FVIIa, the majority occurring in trauma patients However, MedWatch is a database for voluntary ... Davis S, Diringer MN, Skolnick BE, Steiner T; Recombinant Activated Factor VII Intracerebral Hemorrhage Trial Investigators: Recombinant activated factor VII for acute intracerebral hemorrhage ... warranted in this patient Life-threatening hemorrhage and coagulopathy in critical care patients carries significant morbidity and mortality, with increased incidence of respiratory failure and...
- 4
- 304
- 0
Báo cáo y học: "Donnan effect on chloride ion distribution as a determinant of body fluid composition that allows action potentials to spread via fast sodium channels" pot
Ngày tải lên :
13/08/2014, 16:20
... potential that allows the sodium channels to function (Figure 1, A1 ) can be achieved only if the membranes are almost impermeable to Na+ (field A2 ), since any substantial sodium current would make ... membrane potential less negative than -80 mV, and this would leave sodium channels inactive after repolarization INDIVIDUAL EXCITABLE CELL HOMEOSTASIS Spreading of action potential Membrane permeability ... A1 : Fast voltage gated sodium channels require a stable -80 mV resting membrane potential A2 : low for Na+ A3 : hig h for K+ A4 : High Cl- permeability dampens small changes in membrane potential,...
- 9
- 310
- 0
What to look for when you want to invest in a company by geoffrey byruch
Ngày tải lên :
30/11/2015, 10:43
... properly Looking at its annual history of its net income and profit margins will be a sufficient amount of information to make your decision to invest TALK TO A LAWYER OR FINANCIAL ADVISOR • If ... THE COMPANY’S BUSINESS MODEL • A business model is an abstract representation of an organization The overall model should essentially break down the strategy that a company will use to maximize ... before you invest in a company, it is vital that you your homework • When I talk about homework, I am talking about the history and financial status of the company you are thinking about investing...
- 12
- 327
- 0
Editorial Stanley Publishing A To Zed or A To Zee
Ngày tải lên :
05/10/2012, 08:22
... status stat-us state- US strychnine strik-nine strik-neen tomato tom-ay-doe tom-ah-toe trait trayt tray trauma trah-ma trau-ma vase vayz vahz vitamin vy-ta-min vit -a- min Z zee zed A TO ZED, A TO ... cautious, calculating habits; and they have always more or less of a nasal twang.' A TO ZED, A TO ZEE PART THREE Grammar and Usage In grammar and syntax, American and British English are remarkably ... it is long and firm: Returning from the daaanse claaase, she ran a baaath Near the end of the 18th century, southern England began to change from what is called a flat a to a broad a in these...
- 128
- 632
- 2
How to interview like a top mba
Ngày tải lên :
11/03/2013, 15:28
... the impact that interview coaching can bring, as I have watched those students gain access to top graduate schools such as Harvard, Stanford, Yale, and Columbia, and top companies such as McKinsey ... company and the available job The résumé is also important It should say something meaningful about a candidate’s accomplishments and goals, and how those are related to the available job and ... Therefore, what sorts of pitfalls should you avoid, and what are good impressions to try to make in an informal interview? They are much the same as in the formal interview Here’s what Edward, a manager...
- 254
- 731
- 35
Đặc trưng văn hóa – dân tộc của tiếng Việt, những nghiên cứu khởi đầu
Ngày tải lên :
06/04/2013, 10:24
... gọi thực vật tiếng Anh, tiếng Nga tiếng Kazakstan, Cao Thị Thu nhận thấy tư người Việt trình định danh thực vật gần với người Kazakstan hơn, sau người anh Đặc trưng văn h a - dân tộc thành ngữ ... D a theo biểu tượng vị trí, từ Tóu tiếng Hán có hai ngh a phái sinh la 1b từ Đầu tiếng Việt Nhưng dòng phái sinh thứ hai từ tóu lại có hai ngh a tương tự với hai ngh a 2b 2c tiếng Nga, ngh a ... gọi tha cằn (tức mắt ngày) Cái đối tượng người Việt gọi d a chuột người Nga gọi ozypeu Những tên Nga mượn từ tiếng Hi Lạp mà từ gốc tên d a chuột xupos có ngh a ch a chín, thứ rau ăn dạng ch a chín,...
- 10
- 537
- 2
Đặc trưng văn hóa – dân tộc của tiếng Việt, những nghiên cứu khởi đầu
Ngày tải lên :
17/04/2013, 16:09
... gọi thực vật tiếng Anh, tiếng Nga tiếng Kazakstan, Cao Thị Thu nhận thấy tư người Việt trình định danh thực vật gần với người Kazakstan hơn, sau người anh Đặc trưng văn h a - dân tộc thành ngữ ... gọi loại c a butterblume (ngh a đen hoa vàng bơ) Ngay dân tộc, vào thời kì khác nhau, đ a phương khác có cách gọi tên khác Ví dụ: mà người miền Bắc Việt Nam gọi bao diêm người miền Nam gọi hộp ... gọi tha cằn (tức mắt ngày) Cái đối tượng người Việt gọi d a chuột người Nga gọi ozypeu Những tên Nga mượn từ tiếng Hi Lạp mà từ gốc tên d a chuột xupos có ngh a ch a chín, thứ rau ăn dạng ch a chín,...
- 9
- 475
- 0