chitosan a bioactive polysaccharide in marine based foods

The Complex World of Polysaccharides Edited by Desiree Nedra Karunaratne pptx

The Complex World of Polysaccharides Edited by Desiree Nedra Karunaratne pptx

... Prasun Bandyopadhyay, Alireza Alishahi, Rosa M Raybaudi-Massilia, Jonathan Mosqueda-Melgar, Marina Dello Staffolo, Alicia E Bevilacqua, Mar a Susana Rodríguez, Liliana Albertengo, Mar a Victoria Busi, ... Polysaccharide- Protein Interactions and Their Relevance in Food Colloids 395 Amit K Ghosh and Prasun Bandyopadhyay Chapter 15 Chitosan: A Bioactive Polysaccharide in Marine- Based Foods 409 Alireza Alishahi Chapter ... Kaldas, John T Arnason and Paul A Charpentier Chapter 20 Polysaccharides from Red Algae: Genesis of a Renaissance 535 Mar a Josefina Carlucci, Cecilia Gabriela Mateu, Mar a Carolina Artuso and...

Ngày tải lên: 31/03/2014, 19:20

648 563 0
Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn Quốc (Trường hợp ở Hà Nội và Seoul)

Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn Quốc (Trường hợp ở Hà Nội và Seoul)

... The incarnations and the basic functions of incarnation ritual 2.2.2.1 The incarnations A ritual of len dong often include multiple incarnations, each corresponding to each of the saint incarnated ... divided into Antangsakyongmachi and SenamGut Antangsakyongmachi include Chutangmulrim , Pulsakori, Chongkamang, Chosangkori, Sangsankori, Pyongsangkori, Sinchangkori, Taekamkori, Chosokkori and Changpukori ... features within each possessed of particular and general celebration 2.4.1.2 Dance and music Hat van also known as Chau van, hat bong This is a type of Vietnamese traditional singing, also a...

Ngày tải lên: 20/04/2014, 16:09

18 813 0
Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn16211020150227

Comparing Len Dong ritual of Vietnamese and Gut of Korean (the case study in Hanoi and Seoul) = So sánh nghi lễ lên đồng của người Việt Nam và Gut của người Hàn16211020150227

... are saint descended but not incarnated, and there are saints at one descended and incarnated There are two forms of saints descending is called Giang trum khan ( Hau trang man or Giang mo khan) ... of a saint as to can Quan, can Co, can Cau, can Ong Hoang The ceremony usually has average at least over 10 incarnations, or 15, if more then 20 incarnatins The descending of the Saints in front ... Choson dynasty and is accompanied by accessories such as crown caps, collars Individuals Gut generally and SenamGut in Seoul in particular are clearly distinguished with national Gut and village Gut,...

Ngày tải lên: 30/03/2015, 14:55

106 507 0
A CASE STUDY ON COMMON PROBLEMS IN LEARNING BUSINESS ENGLISH VOCABUALRY IN THE BOOK “BUSINESS BASICS” FACED BY THE 1ST YEAR STUDENTS AT VIETNAM UNIVERSITY OF COMMERCE, AND SOME SUGGESTED SOLUTIONS

A CASE STUDY ON COMMON PROBLEMS IN LEARNING BUSINESS ENGLISH VOCABUALRY IN THE BOOK “BUSINESS BASICS” FACED BY THE 1ST YEAR STUDENTS AT VIETNAM UNIVERSITY OF COMMERCE, AND SOME SUGGESTED SOLUTIONS

... defined as “ free-standing items of language that have meaning For example: the word “eating” is freestanding in itself, and that within it has another potentially freestanding element “eat”, independently ... little teaching is done in the target language Instead, readings in the target language are translated directly and then discussed in the native language, often precipitating in- depth comparisons ... and the ultimate goal of learning a language CLT places great emphasis on helping students use the target language in a variety of contexts and places great emphasis on learning language functions...

Ngày tải lên: 29/01/2014, 00:23

42 1,3K 3
Measurements and Mitigation of Peer-to-Peer-based Botnets: A Case Study on Storm Worm ppt

Measurements and Mitigation of Peer-to-Peer-based Botnets: A Case Study on Storm Worm ppt

... any state, it generates again a key and starts searching for it By repeating this process over and over again, we are able to enumerate the keys used by Storm in a black-box manner, without actually ... Storm: propagation mails that contain different kinds of social engineering campaigns as introduced in Section 3.1 or general spam messages that advertise for example pharmaceutical products ... function that computes the key The drawback of this approach is that the attacker can easily change f and then we need to analyze the binary again, thus we are always one step Figure 1: Keys generated...

Ngày tải lên: 23/03/2014, 13:20

9 560 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

... which articulates participation in the organization, in particular the line-customer teams They are an essential tool in explaining the goals reached In Irizar, all the work is organized around ... Irizar Brazil and Irizar Mexico, with a shareholding in International Hispacold, all to be able to service the growing demand in these markets At the same time, a systematic application of KM was ... organization’s mission and values The KM strategy implementation began at Irizar in 1991, a moment in which the firm was in a critical situation, having accumulated major losses almost to the point...

Ngày tải lên: 24/01/2014, 00:20

10 1,1K 1
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

... facilitates degradation of starch granules by the enzymes containing such a domain Throughout this paper, domain E is referred to as SBD, the starch-binding domain In a classification of carbohydrate-binding ... evolutionary trees calculated for individual domains also reveals that a transition occurs in parts of the proteins which are C-terminal to domain A, discriminating the various GH 13 hydrolases from ... CGTases; yellow, acarviose transferase; pink, maltogenic a- amylase; blue, a- amylases from Bacillus and actinomycetes; light blue, a- amylases from fungi and yeast; green, maltotetraohydrolases and...

Ngày tải lên: 08/03/2014, 08:20

11 616 0
lecture 11 dietary fiber and vitamin analysis

lecture 11 dietary fiber and vitamin analysis

... Vitamin analysis • Vitamin A: The test sample is saponified with ethanolic KOH, vitamin A (retinol) is extracted into organic solvent and then concentrated Vitamin A isomers – all-transretinol and ... unstable vitamins such as these, antioxidants are routinely added to inhibit oxidation Vitamin analysis • Bioassay Methods: – vitamins B12 and D • Microbiological Assays: – water-soluble vitamins – ... growth of a certain microorganism in an extract of a vitamin-containing sample is compared against the growth of this microorganism in the presence of known quantities of that vitamin • Chemical Methods...

Ngày tải lên: 08/03/2014, 15:35

3 242 1
Population Ageing, Elderly Welfare, and Extending Retirement Cover: The Case Study of Sri Lanka potx

Population Ageing, Elderly Welfare, and Extending Retirement Cover: The Case Study of Sri Lanka potx

... result in an aggregate fall in savings, with attendant rises in the cost of capital (assuming unchanged demand for capital and constraints on capital inflows) and a dampening of investment demand and ... protection, and how adequate are they? What are the gaps in coverage, and what options are available to extend access affordably? vii Key findings Ageing and dependency Sri Lanka’s old age dependency ratio ... savings increases the funds available for investment, thus lowering the cost of capital and increasing investment demand particularly where access to international capital is constrained Measures...

Ngày tải lên: 14/03/2014, 17:20

104 534 0
Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

... molecular interface In the ab initio simulations, the entire molecular surface was searched using absolutely no additional information regarding the binding sites Among the 1000 candidate protein–protein-docked ... channels from rat brain synaptosomes Rat brain synaptosomes (P2 fraction) were prepared according to Gray and Whittaker [19] Protein content was assayed by a modified Lowry method [125I]Apamin ... on apamin-sensitive SK channels from rat brain synaptosomes Concentration-dependent inhibition of binding of [125I]apamin to rat brain synaptosomes by either unlabeled apamin (d) or sPi4 (s) in...

Ngày tải lên: 17/03/2014, 10:20

10 503 0
Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx

Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx

... Substrate VanXYCa D59S D5 9A VanXYCa D59S D5 9A D-Ala-D-Ala a D-Ala-D-Ala D-Ala-D-Ala UDP-MurNAc-pentapeptide[Ala] UDP-MurNAc-pentapeptide[Ala] UDP-MurNAc-pentapeptide[Ala] Km (mM) kcat (s)1) kcat/Km ... (CGTCTG GTAGCTGGGTAT/AATGTCCTTTTCTAGTCC),P/W (AGTTATGAATGGTGGCATTTTCG/GATACCGGT GATCTCTTG) and Q/V (GGAAAAAGAAGTGCGA CG/GTACGATACCCATCTACC), respectively (mismatch mutations are underlined) The ... used to amplify vanXYC using pAT704 as template with primers C (5¢-CTCAGGATCCAACACA TTACAATTGATCAATA-3¢) and D (5¢-CACTAAGCTT TCATGCGAACTGCCTCAC-3¢) that included BamHI and HindIII restriction...

Ngày tải lên: 18/03/2014, 01:20

7 414 0
Spatial modelling of air pollution in urban areas with GIS: a case study on integrated database development doc

Spatial modelling of air pollution in urban areas with GIS: a case study on integrated database development doc

... values of variables are transferred and incorporated into the GIS database, which can be useful in managing data time series To accommodate large data sets and many variables such as air quality ... relational database, so that the geospatial coordinate data of the GIS data layers are stored in the relational data tables Since the relational database supports relationships between its tables, ... spatial and temporal data, complex analyses, and visualization, (Matejicek, 2002) Due to the ability to manage a number of spatial and temporal data formats, data structures created in the framework...

Ngày tải lên: 23/03/2014, 02:20

6 498 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

... [8] indicate that its alanineglyoxylate aminotransferase activity is not favored over aminobutyrate-pyruvate, b-alanine-pyruvate and dimethylarginine-pyruvate aminotransferase activities In the ... Apolipoprotein A- IV Actin, b, cytoplasmic NSFL1 (p97) cofactor (p47) Aminoacylase Phosphoglycerate mutase Indolethylamine N-methyltransferase Peroxiredoxin Apolipoprotein A- I Abhydrolase domain containing ... Agt), alanine-glyoxylate aminotransferase knockout; Aldh2, aldehyde dehydrogenase 2; Car3, carbonic anhydrase 3; Cat, catalase; Dao1, D-amino acid oxidase 1; Eno1, enolase 1, a non-neuron; Fah,...

Ngày tải lên: 23/03/2014, 03:20

9 482 0
Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot

... cDNA cDNA library – – +d +d +d +d +d + ND ND Primer pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢ b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢ ... a human homologue The mature protein contains a single transmembrane domain, and is proposed to be oriented with a small intracellular C-terminal part and an extracellular N-terminal comprising ... 50-amino-acid region skipped in the MUC15/S splice variant is shown and a poly (A) tail of 18 nucleotides Two alternative poly (A) signals [A( 1259)TAAA and A( 1430)ATTAAA] giving rise to poly (A) tails...

Ngày tải lên: 24/03/2014, 04:21

9 614 0
Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx

Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx

... oleic acid [2] The complex was named HAMLET and was defined as a complex between partially unfolded a- lactalbumin and oleic acid Human a- lactalbumin is a globular 14.2 kDa milk protein (123 amino acids), ... states On the basis of these data, a putative binding site of the C18:1 fatty acid was proposed to involve the b-sheet domain of a- lactalbumin Similar to human a- lactalbumins in HAMLET, equine ... Fatty acid binding to a- lactalbumin and equine lysozyme The conformational change obtained by removing Ca2+ enables the protein to interact with fatty acids [2] The fatty acid specificity in HAMLET...

Ngày tải lên: 29/03/2014, 21:20

12 526 0
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf

... CCTTGGTGCAAGCCTTGTTATCAAAC GAAGTGCACCGCTGATAATAACAAATG CATTTGTTATTATCAGCGGTGCACTTC GTTTGATAACAAGGCTTGCACCGCTG CAGCGGTGCAAGCCTTGTTATCAAAC GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC pPic9Kmpaf ... opafK9Ase opafK9Arev opafK35Ase opafK35Arev opafK38Ase opafK38Arev opafK35,38Ase opafK35,38Arev opafK9Ase opafK9Arev GGAAAATGCACCGCTTCTAAGAACG CGTTCTTAGAAGCGGTGCATTTTCC GTTTGATAACAAGGCTTGCACCAAGG ... (Table ) Loop (9–12) and loop (18–23) create a b-turn A characteristic of the PAF loop regions is the recurring asparagine–aspartate or aspartate–asparagine (Asn18– Asp19, Asp32–Asn33, Asp39–Asn40)...

Ngày tải lên: 29/03/2014, 23:20

16 409 0
Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

Báo cáo khoa học: Preparation and characterization of geodin A bc-crystallin-type protein from a sponge pot

... the stability of geodin in urea resembles that of protein S rather than that of a mammalian crystallin such as cS-crystallin, a qualitative, indirect indication of a closer structural relationship ... Mod-gamma Mod-gamma domain-1 domain-2 domain-1 domain)2 Fig A model of geodin built using the structure of protein S (1 prs) as a template Inter-domain interface residues are shown as yellow ball-and-stick ... summarized in Table 2, indicated that the interface in mod-prs is larger, more planar, although less circular than that in mod-gamma The interacting surfaces in mod-prs are more complementary, as...

Ngày tải lên: 30/03/2014, 15:20

13 442 0
báo cáo hóa học: " CD200-CD200R dysfunction exacerbates microglial activation and dopaminergic neurodegeneration in a rat model of Parkinson’s disease" pot

báo cáo hóa học: " CD200-CD200R dysfunction exacerbates microglial activation and dopaminergic neurodegeneration in a rat model of Parkinson’s disease" pot

... were analyzed and each sample was analyzed in duplicate Statistical analysis Statistical analysis of the data was performed using GraphPad Prism version 5.00 for Windows (GraphPad Software, San ... Contralateral rotation measurements following administration of apomorphine in each experimental group are shown in bar graph at days and 21 days post-6-OHDA injection Data are presented as mean ... Harada M, Kondo T, Riederer P, Inagaki H, Minami M, Nagatsu T: Interleukin-1 beta, interleukin-6, epidermal growth factor and transforming growth factor-alpha are elevated in the brain from parkinsonian...

Ngày tải lên: 19/06/2014, 22:20

12 359 0
báo cáo hóa học: " A case study on co-exposure to a mixture of organic solvents in a Tunisian adhesive-producing company" potx

báo cáo hóa học: " A case study on co-exposure to a mixture of organic solvents in a Tunisian adhesive-producing company" potx

... collection, data analysis, data interpretation, manuscript writing, and final approval of manuscript MK was involved in the conception and design of the project, data collection, data analysis, data interpretation, ... writing, and final approval of manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Gargouri et al Journal of ... data collection, data interpretation, manuscript writing, and final approval of manuscript DZN was involved in the conception and design of the project, data interpretation, manuscript writing,...

Ngày tải lên: 20/06/2014, 00:20

8 642 0
Báo cáo khoa học: "Alternative low doses and routes of administering a prostaglandin F2α analogue to induce luteolysis in Nelore cows" ppt

Báo cáo khoa học: "Alternative low doses and routes of administering a prostaglandin F2α analogue to induce luteolysis in Nelore cows" ppt

... noitalupinam dna nrettaP FM zenitraM ,SP illesuraB ,AG oB 44-73 ,64 ,9891 minA dnI loB asocumbusovluvartni uo ralucsumartni aiv alep adartsinimda lonetsorpolc ed esod-inim a2 moc sadatart sahlivon ... noitanimesni laicifitrA JM sdleiF ,CA kcinraW ,RD nidraH 21 917-517 ,75 ,5002 cetooZ teV deM sarB qrA anivob aemêf ad latineg oãgró od asonev arutetiuqraoignA DJ seãramiuG ,RAT aluaP ,CAC sednanreF ... slamina mraf ni pihsnoitaler nairavoretu cimetsys susrev lacoL JO rehtniG a 012-102 ,22 ,8991 laminA oãçudorpeR ed arielisarB atsiveR riG a ar ad sacav me oãçaluvo ad oãçazinorcnis e ralucilof acimâniD...

Ngày tải lên: 07/08/2014, 18:21

4 223 0
w