charles s law the volume temperature relationship of a gas

Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system

Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system

... simulate the temperature of the exterior wall of the room This temperature curve simulated the exterior surface and was assumed to be at a constant value of 320K A 3-D Cartesian mesh inside room ... Professor of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu ... these studies have limitations with respect to the nature of the disturbance and the time delay; they are limited to small disturbance in temperature as well as small time delay in heat exchange...

Ngày tải lên: 05/09/2013, 16:11

12 557 0
Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc

Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc

... basal levels [25] On the other hand, ectoenzymes producing cADPR (such as CD38 and CD157) and transport systems for cADPR in the plasma membrane open the possibility that cADPR acts as a paracrine ... probability of Ca2+ channels, either localized in the membranes of intracellular Ca2+ stores or in the plasma membrane Such Ca2+ entry channels in the plasma membrane and Ca2+ release channels ... Because the cADPR ⁄ Ca2+ signalling system was also observed in protozoa and plant cells, it appears to be a phylogenetically old and conserved system As for the InsP3 ⁄ Ca2+ signalling system,...

Ngày tải lên: 20/02/2014, 01:20

8 469 0
Báo cáo y học: "What does the structure-function relationship of the HIV-1 Tat protein teach us about developing an AIDS vaccine?" ppsx

Báo cáo y học: "What does the structure-function relationship of the HIV-1 Tat protein teach us about developing an AIDS vaccine?" ppsx

... characterization of six Tat variants J Biol Chem 1999, 274:11473-11478 Ranga U, Shankarappa R, Siddappa NB, Ramakrishna L, Nagendran R, Mahalingam M, Mahadevan A, Jayasuryan N, Satishchandra P, Shankar ... post-challenge in Tat Oyi vaccinated macaques Surprisingly, the macaque that had the lowest viremia had no antibodies against SHIV envelop proteins This macaque was challenged again, and the animal ... evaluated Apoptosis and the role of Tat The hallmark of disease progression in HIV-1 infected individuals is an increased virus load [78] and the progressive loss of CD4+ T cells [79] Apoptosis,...

Ngày tải lên: 12/08/2014, 23:21

13 648 0
Báo cáo y học: "Ethnic differences in the mother-son relationship of incarcerated and non-incarcerated male adolescents in the Netherlands" docx

Báo cáo y học: "Ethnic differences in the mother-son relationship of incarcerated and non-incarcerated male adolescents in the Netherlands" docx

... individuals with similar patterns of, in this case motherson relationships, which can explain associations of a set of variables The parameters in a LCA model are class specific symptom profiles (which ... Moroccan parents of incarcerated and non-incarcerated adolescents, Latent Class Analysis (LCA) was used LCA is a statistical method which is used to identify a set of mutually exclusive latent classes ... classes that account for the distribution of cases that occur within a cross tabulation of observed variables [36] In other words, the purpose of a LCA is to find the smallest number of classes of...

Ngày tải lên: 13/08/2014, 18:22

10 328 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... deletes a large number of small files Sprite LFS is almost ten times as fast as SunOS for the create and delete phases of the benchmark Sprite LFS is also faster for reading the files back; this is ... as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved ... this purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

... multi-stage desalination system consists of Ns number of such stages stacked one over the other The condenser surface of bottom stages acts as the evaporator surface for the stages above The system ... various design and operating parameters on the performance and thermal characteristics of the system Description of the multi-stage evacuated solar desalination system The Multi-stage evacuated solar ... multi-stage and evacuated solar stills coupled to solar thermal collectors The experimental and analytical investigation of the multi-stage solar still, which consists of a stacked array of distillation...

Ngày tải lên: 05/09/2013, 16:11

26 568 0
the meaning and structure of a narrative a systemic functional analysis

the meaning and structure of a narrative a systemic functional analysis

... from the other models of language, systemic functional linguistics possesses a number of analytical instruments, which helps researchers tackle grammatical, semantic, and discoursal problems of a ... on these fundamental theories in analyzing a text teachers of English can further analyze the mistakes that learners easily make in specific situations Last but not least, a number of analytical ... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis...

Ngày tải lên: 07/09/2013, 13:48

39 827 2
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

... The meaning and structure of a science fiction story: A sysyemic 29 Clauses and Clause Complexes Analysis The analysis of the text into clauses and clause complexes and their logico-semantic ... || Theyll rescue us soon. ||| The analysis shows that the text XVI which read as Its all right, she said consists of 36 clauses which make up 18 to the man We can breathe the air its a clause ... the analysis of a science fiction story, using systemic functional linguistics as the theoretical framework As can be seen from the analysis, systemic functional linguistics is a model of language...

Ngày tải lên: 12/02/2014, 20:20

18 714 4
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC ... genomic DNA contamination, the RNA from the eyecups were treated with DNase I and cDNA synthesis was carried out with (+) or without ()) reverse transcriptase On the basis of the sequences available ... Immunostaining of zebrafish retinal section using antibodies for GS and RPE65c Fig S3 Hypothesized molecular mechanisms of the in vitro assay system and the intra-retinal visual cycle This supplementary...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... phytases Thus, PhyH-DI fused to another single-domain phytase may improve the catalytic efficiency of the latter Materials and methods Strains, plasmids and chemicals E coli Trans1-T1 (TransGen, ... Brilliant Blue R250 Protein concentration was determined using the Bradford assay with BSA as the standard [28] Phytase activity assay Phytase activity was determined by measuring the amount of ... BPPs would improve the catalytic efficiency was assessed Results Microorganism isolation Using phytase screening and low phosphate media, three strains with phytase activity were isolated from the...

Ngày tải lên: 14/02/2014, 15:20

9 802 0
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx

... states are comprised of a mainland and islands, such as Australia, which consists of the mainland and islands including Tasmania, Norfolk, and very distant islands like Christmas and Keeling A ... West Bank) phrases is vital in assessing what it is that policymakers, and specifies that “ [a] rrangements for safe passage of such as President George W Bush and Secretary of State persons and ... guard the passage, or what criteria Article XXIX of Oslo II deals with safe passage, and states Israel would use in granting safe passage permits For that “ [a] rrangements for safe passage of...

Ngày tải lên: 16/02/2014, 11:20

64 307 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

... very small As observed for the case of phosphate binding, the signals for intermediate redox stages and of haems III and IV are the more affected This suggests that the binding of phosphate and ... tube the values for the redox–Bohr interactions and the macroscopic pKa values are absolute, and therefore the macroscopic pKa values of the various redox stages show only very small modifications ... structure was not affected The pH of the samples was adjusted using small volumes of NaO2H or 2HCl solutions In the reduced and intermediate 2257 Thermodynamic parameters in ligated proteins stages of...

Ngày tải lên: 19/02/2014, 17:20

10 640 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

... OS KERNEL OS KERNEL OS I/O SUBSYSTEM OS I/O SUBSYSTEM NETWORK ADAPTERS The OMG has issued a request for proposals (RFP) on a new Notification Service [20] that has generated several responses ... (consumers) As a result, the message delivery mechanism does not assign thread priorities according to the priorities of publishers or subscribers In contrast, the TAO Event Service utilizes QoS parameters ... improved avionics references to suppliers and consumers It appears as a proxy features For example, navigation suites are a source of continconsumer to the real suppliers on one side of the channel and...

Ngày tải lên: 19/02/2014, 18:20

20 738 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases, the replacement of this aspartate with an alanine diminishes protease activity ... However, the ASAs of Asp113 and His57 remained constant when the side-chain at residue 169 was changed (Fig 3A) These results suggest that the side-chain at residue 169 is responsible for the solvent ... was used for energy minimization The solvent accessible surface areas (ASA) of individual residues in the API variants were calculated with the INSIGHT II/DISCOVER software The radius of the solvent...

Ngày tải lên: 21/02/2014, 03:20

7 603 0
Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc

... many of the standard results on de Rham or Dolbeault cohomology of nonsingular spaces will fail for singular spaces!) The concepts of K¨hler a classes and nef classes are still well defined (a K¨hler ... locally constant vector bundle over S, whose associated sheaf of sections is the direct image sheaf Rk π∗ (CX ) This locally constant system of C-vector space contains as a sublattice the locally ... In the case of projective manifolds, we get stronger and simpler versions of the above statements All these can be seen as an extension of the NakaiMoishezon criterion to arbitrary (1, 1)-classes...

Ngày tải lên: 05/03/2014, 23:20

29 468 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

... quantitative RT-PCR analysis The M sexta ribosomal protein S3 (rpS3) mRNA was used as an internal standard to normalize the amount of RNA template The primer pairs used are listed in Table S2 The thermal ... gaps were treated as characters, and statistical analysis was performed by the bootstrap method, using 1000 repetitions Quantitative RT-PCR analysis of Spatzle-1 mRNA ¨ level Fifth instar day ... proteinase called BAEEase as a candidate proSpatzle-1 ¨ activator, because it is activated by upstream serine proteinase cascade components in the presence of peptidoglycan and b-1,3-glucan, and has sequence...

Ngày tải lên: 06/03/2014, 09:22

15 541 0
Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx

Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx

... in the same office • A database administrator makes an extra copy of the database files, but says the tapes are bad He/she then carries the tapes out, and no one is the wiser • An insider has a ... • Attack: A deliberate attempt to compromise an organization s mission • Case: All events and states in the world associated with a related set of attacks A case may also be a set of other cases ... Build a library of attacks (scenarios) that researchers can use to train and test their anomaly detection systems The first research issue is related to the question of what datasets the researchers...

Ngày tải lên: 06/03/2014, 16:20

137 344 0
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc

... Bsu, B subtilis sucrase-isomaltase-maltase [34]; Bsp3, Bacillus sp a- glucosidase [35], Tcu, Thermomonospora curvata a- glucosidase [36]; Sce727–14C, S cerevisiae maltase (this study); Sca, S carlsbergensis ... Withers [26] indicated that Asp214 on the consensus region II of maltase is the catalytic nucleophile Because the Asp214 of maltase is equivalent to the Asp215 of isomaltase, a mutant with the ... a- glucosidases are identical to their parent enzymes Cloning of yeast a- glucosidases Substrate specificities of chimeric enzymes Two a- glucosidase genes, encoding isomaltase and maltase, were isolated...

Ngày tải lên: 07/03/2014, 16:20

7 452 0
Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx

... kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling modules in eukaryotic cells [20,21] The budding yeast (S cerevisiae) has several MAPK cascades ... case, the proposed method can be applied to any larger cases in the B Fig Temporal expression profiles (A) and a summary of the analysis results (B) for the artificial example system The small circle ... respect to the particular time points sampled as compared to other methods that make use of the measured absolute values at each sampling time point For instance, the result in Fig is the same even...

Ngày tải lên: 07/03/2014, 21:20

10 375 0
w