characteristics of a natural language interface

Combustion and emission characteristics of a natural gas fueled diesel engine with EGR

Combustion and emission characteristics of a natural gas fueled diesel engine with EGR

... natural gas diesel engine Energy 2010;35:1129–38 [11] Wannatong K, Akarapanyavit N, Siengsanorh S, Chanchaona S Combustion and knock characteristics of natural gas diesel dual fuel engine SAE paper ... Combustion and emission characteristics of a natural gas-fueled diesel engine with EGR M.M Abdelaal, A. H Hegab ⇑ Department of Mechanical Engineering, Al-Azhar University, Cairo 11371, Egypt a r t ... estimate the repeatability of measure- _ m air stoic Accuracy of measurements and uncertainty analysis stoic where (AFR ) and (AFR ) are the stoichiometric air–fuel ratios NG D ment and the accuracy

Ngày tải lên: 15/06/2014, 09:26

12 573 0
A Natural Language Human Robot Interface for Command and Control of Four Legged Robots in RoboCup Coaching

A Natural Language Human Robot Interface for Command and Control of Four Legged Robots in RoboCup Coaching

... serves as an index into a database of mappings Meaning: The meaning component of the pair is encoded in a predicateargument format in the Scene Event Array (SEA) The SEA is also a x 25 array that ... Communicative Performance: We have demonstrated that this model can learn a variety of grammatical constructions in different languages (English and Japanese) (Dominey & Inui 2004) Each grammatical ... goal Pass the ball When a different attacker to the one near the ball has a better position to take a shot, the coach can order the attacker close to the ball to pass the ball to the other attacker

Ngày tải lên: 19/10/2022, 02:51

10 1 0
Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

... percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and has a higher value of maximum heat ... performance and emission characteristics of a DI diesel engine A Gopinath1, Sukumar Puhan2, G Nagarajan3 Product Development, Ashok Leyland Technical Centre, Chennai, Tamilnadu, India Department of ... and exhaust gas temperature was observed in case of high unsaturated biodiesel Heat release rate and cumulative heat release rate is lower in case of high- unsaturated biodiesel fuel A general

Ngày tải lên: 05/09/2013, 15:28

20 483 0
Báo cáo lâm nghiệp: "Conversion of a natural broad-leafed evergreen forest into pure plantation forests in a subtropical area: Effects on carbon storage" pps

Báo cáo lâm nghiệp: "Conversion of a natural broad-leafed evergreen forest into pure plantation forests in a subtropical area: Effects on carbon storage" pps

... Ormosia xylocarpa (OX) and Castanopsis kawakamii (CK), with an adjacent relict natural forest of Castanopsis kawakamii (NF, ~ 150 year old) in Sanming, Fujian, China. Overall estimates of total ... (Cunninghamia lanceolata) plantation forest; FH, Fokienia hodginsii plantation forest; OX, Ormosia xylocarpa plantation forest; CK, Castanopsis kawakamii plantation forest; NF, natural forest of C. kawakamii. ... Castanopsis kawakamii, and an adjacent relict natural forest of Castanopsis kawakamii (NF) that as a control, provided a unique opportunity to examine how changes occur following converting a natural forest

Ngày tải lên: 08/08/2014, 00:22

10 384 0
báo cáo khoa học: "Design, rationale, and baseline characteristics of a cluster randomized controlled trial of pay for performance for hypertension treatment: study protocol" ppt

báo cáo khoa học: "Design, rationale, and baseline characteristics of a cluster randomized controlled trial of pay for performance for hypertension treatment: study protocol" ppt

... This approach may avoid the pitfalls of process -of- care measures alone that can encourage gaming, while avoiding the disadvantage of basing incentives solely on outcomes that may be relatively rare ... Hospitals (COTH) directory or if the American Medical Association’s (AMA) Fellowship and Residency Electronic Interactive Database (FREIDA) database listed the VA facility as having a ‘major’ affiliation ... Administration; VAMC = Veterans Affairs Medical Center *Designated as a teaching facility if the facility was either listed in the Association of American Medical College’s (AAMC) Council of Teaching

Ngày tải lên: 10/08/2014, 11:20

12 353 0
Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps

Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps

... primer 5’ACTAGTGTTGGATCCTAACAACGTTCGGCATGGAGCTAGGTATAGCAGTAGCAAATATGGATGTAAAACTACAGATAG-3’, 2) the mutant designated VRB3aa using primer 5’-GAGGGAGTAATCAGGACAATAGCTGCACAGGAAAATGCAACCCCC-3’, ... prototype FeLV -A isolates FeLV -A/ 61E [GenBank:AAA93093], FeLV -A/ 3281 [GenBank:AAA43051] and FeLV -A/ Glasgow [GenBank:AAA43053], from FeLV-945 [GenBank:AAT76450] and from other representatives of the cohort. ... obtained in three replicate assays at each concentration by nonlinear regression analysis using saturation binding kinetics equations in GraphPad Prism5.0 (GraphPad Software, Inc., La Jolla,

Ngày tải lên: 13/08/2014, 01:20

17 267 0
Báo cáo y học: "Whole genome sequencing of a natural recombinant Toxoplasma gondii strain reveals chromosome sorting and local allelic variants" ppsx

Báo cáo y học: "Whole genome sequencing of a natural recombinant Toxoplasma gondii strain reveals chromosome sorting and local allelic variants" ppsx

... A TgCkUg2 C A A T C C C C C T A A G C C A TgCkUg3 C A A T C C C C C T A A G C C A TgCkUg8 C A A T C C C C C T A A G C C A GT1 (I) CAATCCCCCTAAGCCA Similarities to the Me49 sequence are indicated ... Uganda has revealed chromosome sorting and local allelic vari-ants.</p> Abstract Background: Toxoplasma gondii is a zoonotic parasite of global importance. In common with many protozoan parasites ... SNP data generated in this study and the availability of the putative parental strains to this natural recombinant provide an excellent basis for future studies of the genetic divergence and of

Ngày tải lên: 14/08/2014, 21:20

17 324 0
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

... OF BOTANICAL FLAVONOIDS AS DUAL PEROXISOME PROLIFERATOR ACTIVATED RECEPTOR (PPAR) LIGANDS AND FUNCTIONAL CHARACTERIZATION OF A NATURAL PPARα POLYMORPHISM THAT ENHANCES INTERACTION WITH NUCLEAR ... PPARα and PPARγ activity 103 3.3 Characterization of flavonoids and PPARα ligands on a natural PPARα V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated PPARα V22 7A activity 140 ... SD of three replicates, and expressed as percentage of maximal WT activity. * p[...]... transactivation by PPARs involves ligand binding PPARs are activated by a wide range of naturally

Ngày tải lên: 12/09/2015, 08:20

263 267 0
Development of a graphic user interface based on OpenGL for a drop on demand micro bio fabrication system

Development of a graphic user interface based on OpenGL for a drop on demand micro bio fabrication system

... DEVELOPMENT OF A GRAPHIC USER INTERFACE BASED ON OPENGL FOR A DROP-ON-DEMAND MICRO/BIO FABRICATION SYSTEM CHEN JUEXUAN NATIONAL UNIVERSITY OF SINGAPORE 2013 DEVELOPMENT OF A GRAPHIC USER INTERFACE BASED ... convenience and accurateness in applications Finally, this three-dimensional model has been analyzed to be various parameters of print head nozzle tip in order to extract main detail information from ... National University of Singapore, 2010 [20] L Chang, E S Thian, J Sun, J Y H Fuh, G S Hong, Y S Wong and W Wang, “Fabrication of functionally graded Hydroxyapatite/Titanium Oxide Coating via

Ngày tải lên: 04/10/2015, 15:46

78 383 0
DSpace at VNU: Response’s Probabilistic Characteristics of a Duffing Oscillator under Harmonic and Random Excitations

DSpace at VNU: Response’s Probabilistic Characteristics of a Duffing Oscillator under Harmonic and Random Excitations

... present paper, response’s probabilistic characteristics of a Duffing oscillator under harmonic and random excitations are analyzed by a new technique using the stochastic averaging and equivalent ... σ b2 and σ d2 are variance of b and d , respectively, and kbd is covariance of b and d It is seen from (19) that necessary statistics of processes b and d can be computed algebraically based ... Elishakoff, L Andrimasy, M Dolley, Application and extension of the stochastic linearization by Anh and Di Paola Acta Mech, 204 (2008) 89 [15] N.D Anh, N.N Hieu, N.N Linh, A dual criterion of equivalent

Ngày tải lên: 12/12/2017, 13:53

11 84 0
Slides 12 3 identify the characteristics of a cost managed o

Slides 12 3 identify the characteristics of a cost managed o

... Huachuca Case Study Cost Command and Control © 2000-11 Dr Dale R Geiger CMA CGFM drgeiger@manage.gov.org Terminal Learning Objective  Task: Identify the Characteristics of a Cost Managed Organization ... of Major Command Resource Managers  Included Dr Geiger as Academic Advisor  Teamed with LTG (Ret) Carney to “Armyize” ideas on cost management  Initiated pilots in garrisons at Ft Huachuca, ... now a way of life and I don’t know how we operated without it.” As a member of the Air Force Managerial Cost Accounting Council, I found the Fort Huachuca Garrison Cost Management After Action

Ngày tải lên: 08/01/2018, 10:50

29 155 0
Diabetes MILES Youth–Australia: Methods and sample characteristics of a national survey of the psychological aspects of living with type 1 diabetes in Australian youth and their parents

Diabetes MILES Youth–Australia: Methods and sample characteristics of a national survey of the psychological aspects of living with type 1 diabetes in Australian youth and their parents

... format was a successful and economical approach for engaging young people with type diabetes and their parents This rich quantitative and qualitative dataset focuses not only on diabetes management ... diabetes distress is related to other psychological problems (e.g depressive symptoms), and to diabetes management, as well as family and health professional support Few data are available about ... in the Australian context Aim The aim of the MILES Youth Study was to investigate psychological and behavioural issues in a large-scale, national sample of young people (aged 10–19 years) with

Ngày tải lên: 10/01/2020, 13:32

13 57 0
Genetic origin and composition of a natural hybrid poplar Populus × jrtyschensis from two distantly related species

Genetic origin and composition of a natural hybrid poplar Populus × jrtyschensis from two distantly related species

... Wang H, Graham JH, Freeman DC Nine‐year reciprocal transplant experiment in the gardens of the basin and mountain big sagebrush (Artemisia tridentata: Asteraceae) hybrid zone of Salt Creek Canyon: ... applicable Availability of data and materials The datasets supporting the conclusions of this article are included within the article and its additional files The nuclear genes sequences datasets ... 12 Table Analyses of molecular variance (AMOVA) for three poplar species based on datasets for two markers Grouping of regions Source of variation d.f SS VC Percent variation Fixation index Among

Ngày tải lên: 22/05/2020, 04:18

12 8 0
The Nightingale study: Rationale, study design and baseline characteristics of a prospective cohort study on shift work and breast cancer risk among nurses

The Nightingale study: Rationale, study design and baseline characteristics of a prospective cohort study on shift work and breast cancer risk among nurses

... al [28], Kamdar et al [29], Jia et al [30], and Ijaz et al [31] have provided little more clarity on the potential association between shift work and breast cancer risk in humans than what was ... employed as a nurse as well as women who changed careers and those who retired Addresses and vital stats are kept up to date by automated linkage with the Municipal Personal Records Database The ... the data, no need for data entry and less data cleaning afterwards We designed the online system to enable participants to save what they already completed and log off to log in again later to

Ngày tải lên: 05/11/2020, 02:05

13 19 0
Some biological characteristics of a species of lithocarpus fissus for large timber production in doan hung district phu tho province

Some biological characteristics of a species of lithocarpus fissus for large timber production in doan hung district phu tho province

... Kupriantova (1962), putting Nothofagus genus out of Fagaceae In 2008, some botanists arranged Nothofagus genus into Nothofagaceae family (Judd, 2008) 2.1.2 Morphological characteristics Huang ... Ormosia balansae Ràng rang mít Aidia pycnantha Găng gai Gironniera subaequalis Ngát Alphonsea monogyna Thau lĩnh Jatropha curcas Cọc rào Elaeocarpus dubius Côm tầng Erythrophloeum fordii Lim xanh ... Pygeum arboreum Xoan đào 11 Syzygium cumini Trâm 12 Sterculia lanceolata Sang 13 Carallia diplopetala Răng cá 14 Engelhardtia roxburghiana Chẹo t? ?a 15 Cryptocarya concinna Mị vàng 16 Cinnamomum camphora

Ngày tải lên: 23/06/2021, 17:14

49 4 0
Analyzing nearest neighborhood characteristics of a tropical evergreen forest at k’bang district gia lai province using time series data

Analyzing nearest neighborhood characteristics of a tropical evergreen forest at k’bang district gia lai province using time series data

... Podocarpaceae Anacardiaceae Annonaceae Caesalpiniaceae Sterculiaceae Myrsinaceae Myristicaceae Myristicaceae Moraceae Ulmaceae Sapindaceae Ebenaceae Annonaceae Rosaceae Lauraceae Lauraceae Lauraceae ... Lauraceae Lauraceae Lauraceae Oleaceae Myristicaceae Dipterocarpaceae Sapotaceae Dipterocarpaceae Fagaceae Apocynaceae Moraceae Sp Simaroubaceae Ebenaceae Alanginacea Cornaceae Podocarpaceae Podocarpaceae ... Euphorbiaceae Sapindaceae Tiliaceae Burseraceae Elaeocarpaceae Elaeocarpaceae Elaeocarpaceae Mimosaceae Meliaceae Meliaceae Fagaceae Symplocaceae Symplocaceae Symplocaceae Symplocaceae Symplocaceae

Ngày tải lên: 23/06/2021, 17:14

43 9 0
Some biological characteristics of a species of lithocarpus fissus for large timber production in doan hung district phu tho province

Some biological characteristics of a species of lithocarpus fissus for large timber production in doan hung district phu tho province

... Kupriantova (1962), putting Nothofagus genus out of Fagaceae In 2008, some botanists arranged Nothofagus genus into Nothofagaceae family (Judd, 2008) 2.1.2 Morphological characteristics Huang ... Ormosia balansae Ràng rang mít Aidia pycnantha Găng gai Gironniera subaequalis Ngát Alphonsea monogyna Thau lĩnh Jatropha curcas Cọc rào Elaeocarpus dubius Côm tầng Erythrophloeum fordii Lim xanh ... Pygeum arboreum Xoan đào 11 Syzygium cumini Trâm 12 Sterculia lanceolata Sang 13 Carallia diplopetala Răng cá 14 Engelhardtia roxburghiana Chẹo t? ?a 15 Cryptocarya concinna Mò vàng 16 Cinnamomum camphora

Ngày tải lên: 23/06/2021, 17:36

49 13 0
Study on seasonal fluctuation of physicochemical properties of water and fish diversity towards future management of a natural water bodies rajar beel wetland, north 24 parganas, west bengal, india

Study on seasonal fluctuation of physicochemical properties of water and fish diversity towards future management of a natural water bodies rajar beel wetland, north 24 parganas, west bengal, india

... Wiley and Sons, INC., : 773 Basavaraja, D., J Narayana, B R Kiran, and E T Puttaiah (2014) Fish diversity and abundance in relation to water quality of Anjanapura Reservoir, Karnataka, India International ... Thane, Maharashtra Journal of Aquatic Biology 23(1): 22-25 Mamta Joshi, Umerfaruq Qureshimatva and Hitesh A Solanki (2019) PhysicoChemical Parameters of Water in Wadhwana Wetland, Vadodara, Gujarat ... dam, Dist-Jalgaon, Maharashtra Journal of Aquatic Biology., 24(1): 7-12 Karen De Roy, Massimo Marzorati, Andrea Negroni, Olivier Thas, Annalisa Balloi, Fabio Fava, Willy Verstraete, Daniele Daffonchio

Ngày tải lên: 28/06/2021, 09:36

10 5 0
Performance and emission characteristics of a diesel engine running on optimized ethyl levulinate-biodiesel-diesel blends-final accepted version

Performance and emission characteristics of a diesel engine running on optimized ethyl levulinate-biodiesel-diesel blends-final accepted version

... EL available at low production costs Agricultural residues such as wheat straw can also be used as potential raw materials for the production of ethyl levulinate by direct conversion in an ethanol ... grey relational analysis (GRA) and analytic hierarchy process (AHP) Experimental investigations were conducted to evaluate and compare the engine performance and exhaust emissions of the optimized ... residue is also an important biomass feedstock in China due to its vast forest base [27] Although China has abundant crop straw, it suffers from a significant waste of this potential energy resource

Ngày tải lên: 20/10/2022, 20:23

39 1 0
Effectiveness of a Natural Family Planning Service Program

Effectiveness of a Natural Family Planning Service Program

... nonbreastfeeding participants attempting to avoid pregnancy had a mean age of 30.39 (SD = 6.28), were married a mean of 4.60 years (SD = 5.81), they had a mean of 2.13 pregnancies (SD = 2.55), and ... monitor; Natural family planning In 1998, an Institute for Natural Family Planning was established at Marquette University College of Nursing to provide professional education, research, and service ... in natural family planning (NFP) In 1999, a new method of NFP (called the Marquette Model or MM) was developed and launched that entailed use of an algorithm, integration of electronic hormonal

Ngày tải lên: 24/10/2022, 01:03

16 0 0
w