Ngày tải lên: 08/03/2014, 19:20
... will be: available free of charge to the entire biomedical community At a later date, the financial data associated with the personnel flows will be addressed by adding the costs associated with ... for a planner to integrate all the interactions in a meaningful way To overcome this problem and to reduce uncertainty, a computable dynamic model is proposed from which a number of scenarios can ... immediate neighbours and the system as a whole The inclusion of feedback and temporal features makes the model dynamic and non-linear rather than static and linear Nurse, ophthalmology and community...
Ngày tải lên: 18/06/2014, 17:20
Chapter 4: BACKING UP AND RESTORING DATA ppt
... RESTORING DATA BACKING UP DATA • Why we back up data? • Why we need to back up data? Chapter 4: BACKING UP AND RESTORING DATA BACKUP SOLUTION • • • • Backup hardware Backup medium Backup software Data ... UP AND RESTORING DATA 34 ENABLING VOLUME SHADOW COPY Chapter 4: BACKING UP AND RESTORING DATA 35 BACKING UP ACTIVE DIRECTORY Chapter 4: BACKING UP AND RESTORING DATA 36 RESTORING ACTIVE DIRECTORY ... 4: BACKING UP AND RESTORING DATA 27 RESTORING FULL BACKUPS • Easiest of all backup methods to restore • Restores latest full backup Chapter 4: BACKING UP AND RESTORING DATA 28 RESTORING FULL AND...
Ngày tải lên: 01/08/2014, 07:20
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx
... high, saturated genetic maps would be necessary to have very close markers available each time in order to permit a molecular marker-assisted selection The current genetic maps contain around ... of around 80 chromosomes separated into two classes: a few distinguishable macrochromosomes and a much higher number of small microchromosomes, visualized as dots on metaphase preparations and ... will generate more comparative mapping data, and will enable us to test this hypothesis by further estimating the degree of rearrangements between mammals and birds Microchromosomes are also present...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo khoa học: "A model to estimate insulin sensitivity in dairy cows" doc
... resistance: A metabolic pathway to disease Hepatology 2005, 42:987-1000 Lonardo A, Lombardini S, Ricchi M, Scaglioni F, Loria P: Review article: hepatic steatosis and insulin resistance Aliment Pharmacol ... plasma was analysed for glucose, FFA and insulin as previously described [9] RQUICKI was calculated as described by Perseghin et al [7] Before statistical analysis, the data were divided into ... that study the influence of body condition at parturition on metabolism and performance during lactation was investigated Body condition was evaluated as described by Agenäs et al [10] and FFA,...
Ngày tải lên: 12/08/2014, 18:22
Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx
... treatment (Figure 2) TGCTTTCGGAGCGTATATC CCATGTTCAGGGTGTTCTCC GACTCCCTTCAGTGCTCCAG CCGGTAAGACTGGCTGATGT TGAGGGCCTTGTAAGTGAGC CACAAGGGCTGGTACTCCTG GCTTGTACATGCAGGACTGG CCGTGAGCCACTTCCATTAT GGGTCATCATCTCTGCTCCT ... Folgueira MAAK, Carraro DM, Brentani H, Patrão DFC, Barbosa EM, Netto MM, Caldeira JRF, Katayama MLH, Soares FA, Oliveira CT, Reis LFL, Kaiano JHL, Camargo LP, Vêncio RZN, Snitcovsky IML, Makdissi ... increased clinical response rates were associated with high histological grade [27,28] The histological grade seems to be of prognostic value in canine mammary carcinoma patients as in human patients...
Ngày tải lên: 12/08/2014, 18:22
Marketing Test Bank Chapter 4 Managing Marketing Information to Gain Customer Insights
... Communication Skill: Concept Objective: 4-4 57) What is the purpose of a data warehouse? A) to organize internal and external data by relevance B) to gather and integrate information a company already ... managing detailed information about individual customers and carefully managing customer "touch points" in order to maximize customer loyalty By using sophisticated software and analytical tools, ... secondary data likely available? Why? Answer: Because the data sought are so specific, there will likely not be much, if any, data that specifically answer the question Diff: Page Ref: 107 AACSB: Analytic...
Ngày tải lên: 21/11/2016, 10:13
Development of a model to calculate the economic implications of improving the indoor climate
... thermal sensation and performance In practice a model is as good as the data that forms the basis of the model In the BN models in Paper I and Paper II it was strived to make use of the best data ... were applied A statistical model called multivariate linear mixed-effect model was applied to data established in three independent experiments as an illustrative example Multivariate linear mixed-effects ... for each indoor factor that varies) In practice, this is time consuming and difficult to do, so average assumptions are often applied A probabilistic model may be a more appropriate and an easier...
Ngày tải lên: 12/12/2016, 20:32
Characteristics of the hero frederic henry in chapter IV of ‘a farewell to arms’ by earnest hemingway
... has volunteered to serve in the Italian Ambulance Corps for reasons which are nowhere made clear to us He is a non-combatant and is more of a spectator than a participant in the war The loyalty ... America but he has quarrelled so much with his family as hardly to have any communication with them He is an American who came to Italy to study architecture and he speaks fluent 8| P a g e Italian ... each other in a period of upheaval Frederick Henry is an American who serves as a lieutenant in the Italian army to a group of ambulance drivers Hemingway portrays Frederick as a lost man searching...
Ngày tải lên: 28/04/2017, 21:05
Test bank principles marketing 13e chapter 4 managing marketing information to gain customer insights
... Communication Skill: Concept Objective: 4-4 57) What is the purpose of a data warehouse? A) to organize internal and external data by relevance B) to gather and integrate information a company already ... secondary data on the Web, and small firms also have access to special help collecting data from chambers of commerce, government agencies, and other organizations Managers of small organizations can ... online databases Answer: The researcher should evaluate whether the data are relevant, current, unbiased, and accurately presented Diff: Page Ref: 109 AACSB: Analytic Skills Skill: Application...
Ngày tải lên: 10/05/2017, 11:01
Data Mining Classification: Basic Concepts, Decision Trees, and Model Evaluation Lecture Notes for Chapter 4 Introduction to Data Mining pptx
... Tan,Steinbach, Kumar Introduction to Data Mining Decision Tree Classification Task Decision Tree © Tan,Steinbach, Kumar Introduction to Data Mining Apply Model to Test Data Test Data Start from ... Divorced TaxInc < 80K NO © Tan,Steinbach, Kumar Married NO > 80K YES Introduction to Data Mining 12 Apply Model to Test Data Test Data Refund Marital Status No Refund Yes Taxable Income Cheat 80K Married ... Introduction to Data Mining 10 Apply Model to Test Data Test Data Refund Marital Status No Refund Yes Taxable Income Cheat 80K Married ? 10 No NO MarSt Single, Divorced TaxInc < 80K NO © Tan,Steinbach,...
Ngày tải lên: 15/03/2014, 09:20
Tài liệu The Insider’s Guide to PR: Chapter 4 A PR LIFE – THE LADDER, THE PAY AND THE LIFESTYLE doc
... operate a press office which acts as an interface between the brand and the media Getting results is always satisfying Setting up a photocall and then seeing it in the papers the next day is a ... Christmas shopping days 16% Laptop computer 14% Maternity/paternity leave above statutory 13% Duvet days 12% Alternative medicine/treatment 8% Lifestyle vouchers 6% Regular medical examinations ... childcare Assistance with domestic costs 3% 1% Source: Frontline Survey 2001 While it may not be all champagne and caviar as the media would like to portray, the quality of life is good, salaries are...
Ngày tải lên: 13/12/2013, 04:15
Tài liệu Seven Steps to a Successful Business Plan Chapter 4-5 doc
... is to be “off mission.” This creates unit failure and leads to organizational failure How you as a business leader a mission analysis? The same way I did as a combat commander You a mission analysis ... performance Courage to set bold goals comes from pure, old-fashioned leadership A manager can calculate the numbers and figure the odds A manager can perform a risk analysis and make the appropriate ... goals, management must make an open sign that the goals are real The best visible sign that a goal is to be taken seriously is the allocation of resources to that goal You can talk and talk and...
Ngày tải lên: 26/01/2014, 15:20
Tài liệu CHAPTER TwENTY ONE A BIOLOGICAL APPROACH TO A MODEL OF AESTHETIC ExPERIENCE OSHIN VARTANIAN AND MARcos NADAL pdf
... contrast, the studies by Kawabata and Zeki (2004) and Skov ef al (2005) attempted to isolate those cortical structures that are actIvated more when a stimulus is evaluated as beautiful Presumably, ... processing along all five stages of the model The results indicate that evaluating a stimulus as beautiful was asSOCIated WIth mcreased activation in the orbital frontal cortex Activation in the orbital ... neural correlates of preference and beauty, two variables that have affective and cognitive components The areas activated by Vartanian and Goel (2004b) may have highlighted those cOrlical structures...
Ngày tải lên: 19/02/2014, 17:20
A Practical Guide to Particle Counting for Drinking Water Treatment - Chapter 4 pot
... Other Plant Data To relate the particle counter to overall plant performance, trend it together with other plant data Turbidity, headloss, and any other data that relate to water quality and filter ... disadvantage to this approach is that the particle counter data are collected and displayed separately from the other plant data, requiring separate training for the operators, and making comparative ... data an integral part of the plant operational system All data collection, display, historical data storage, and reporting are kept on a single system, providing maximum utility for the operator...
Ngày tải lên: 18/06/2014, 19:20
A Companion to the History of Economic Thought - Chapter 4 ppsx
... transformed into a negative balance of trade They argued that it was this negative balance that had made English exchange rates less favorable and caused a general crisis In this context, we are not ... fruitful and revealing to undertake a more historical reading of what mercantilism really was Hence, in a historical sense, it was a discussion that emphasized the role of trade and manufacture ... Heckscher’s synthesis was aimed at propagating liberal and free trade ideas against protectionism, and against the economic nationalism that was so characteristic of the interwar period Although Hecksher’s...
Ngày tải lên: 06/07/2014, 02:20
Báo cáo y học: "Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate" pot
... 399:130-132 Banavar JR, Damuth J, Maritan A, Rinaldo A: Supply-demand balance and metabolic scaling Proc Natl Acad Sci USA 2002, 99:10506-10509 Darveau C -A, Suarez RK, Andrews RD, Hochachka PW: Allometric ... bone mass is 1.09 [26], and an average of MLEs of the scaling exponent for brain mass is 0.73 [27] The anatomical conceptualization has also been used to develop a five-compartment anatomical model ... and (6) are used to predict log(BMR) The two-parameter model of Equation (4) and the three-parameter model of Equation (7) fit the data approximately equally well, and these models fit the data...
Ngày tải lên: 13/08/2014, 23:20
INTRODUCTION TO KNOWLEDGE DISCOVERY AND DATA MINING - CHAPTER 4 ppsx
... also implies that: A and B must appear together in at least 10,000 transactions; and, A and C must appear together in at least 10,000 transactions; and, A and D must appear together in at least ... the data It follows that: A must appear in at least 10,000 transactions; and, B must appear in at least 10,000 transactions; and, C must appear in at least 10,000 transactions; and, D must appear ... Association rule analysis is an appropriate technique, when it can be applied, to analyze data and to get a start Most data mining techniques are not primarily used for undirected data mining Association...
Ngày tải lên: 14/08/2014, 02:21
A Professional’s Guide to Data Communication in a TCP/IP World phần 4 ppsx
... discarding it Segmenting a large frame 5.2 Bridging 89 Table 5.1 Comparison of Frames on Different LANs Field Size Ethernet IEEE 802.3 Preamble Variable 0×AA-AA -A 0×AA-AA-AA-AAA-AA-AA -A AA-AA-AA-AA ... interface layer IP datagram ATM AAL Convergence sublayer adaptation AAL Segmentation and layer AAL reassembly sublayer 48 byte cells ATM layer 53 byte cells Physical layer ATM adaptation layer parameters ... rate (VBR) stream The bit rate cannot exceed the peak cell rate (PCR) negotiated with the network Data is carried as a VBR stream, as a stream that uses the available bit rate (ABR), or as a...
Ngày tải lên: 14/08/2014, 13:20
artech house a professionals guide to data communication in a tcp ip world 2004 phần 4 pot
... discarding it Segmenting a large frame TLFeBOOK 5.2 Bridging 89 Table 5.1 Field Preamble Comparison of Frames on Different LANs Size Ethernet IEEE 802.3 Variable 0×AA-AA -A 0×AA-AA-AA-AAA-AA-AA -A ... sublayer adaptation AAL Segmentation and layer AAL reassembly sublayer 48 byte cells ATM layer 53 byte cells Physical layer ATM adaptation layer parameters AAL type Bit rate Constant Connection ... In a second approach, known as frame relay: • The user’s data are kept in variable length frames • LAP-D is applied in two steps The data link layer protocol is changed to a limited set of capabilities...
Ngày tải lên: 14/08/2014, 13:20