chain commands with a single alias using cli

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

... novel transactivators with graded transactivation potential Nucleic Acids Res 25, 2723–2729 13 Akagi K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with ... were analyzed alongside on a single blot OCT, organic cation transporter; CAT, cationic amino acid transporter Transporter cDNA (human) Transporter mRNA ⁄ GAPDH mRNA Vector Doxycycline + Name Gene ... CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG Cell culture, transfection, and flow...

Ngày tải lên: 23/03/2014, 09:21

8 331 0
Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

... respectively a- tubulin was used as a marker for cytoplasmic extraction The same membrane was used for immunoblot analysis with aF-N, aF-C and anti- (a- tubulin) Ig Lanes and 4, whole cell lysate; lanes and ... accordance with the embryonal develop- Nuclear and cytoplasmic fractions were prepared from NIH3T3 cells and analyzed by immunoblot analysis As shown in Fig 3A, a major band with a molecular mass ... and the first strand cDNAs were synthesized with avian myeblastoma virus (AMV) reverse transcriptase (Takara Biomedicals) at 45 °C for 60 Partial cDNA fragments for the mLRP130 were amplified with...

Ngày tải lên: 31/03/2014, 23:20

7 305 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

... with an offset of two amino acids (13 amino acid overlap) Each arginine-containing peptide was synthesized as three variants, one with natural arginine, one with sDMA and one with asymmetrical ... 41.3 and 13.9 units, respectively R24 Correlation with racial and clinical parameters When correlating autoantibody specificities with race, there was a statistically significant association of autoantibodies ... dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating...

Ngày tải lên: 09/08/2014, 06:22

11 593 0
Báo cáo y học: "Phase delaying the human circadian clock with a single light pulse and moderate delay of the sleep/dark episode: no influence of iris color" potx

Báo cáo y học: "Phase delaying the human circadian clock with a single light pulse and moderate delay of the sleep/dark episode: no influence of iris color" potx

... African Americans had larger phase advances than Caucasians Because we found that African Americans had a shorter tau than Caucasians, which would augment phase advances relative to the Caucasians ... manuscript we also re-analyzed data from our previous phase-advancing study with daily light pulses [42] that included both light and dark-eyed Caucasians as well as dark-eyed African Americans, and thus ... circadian adaptation J Biol Rhythms 1997, 12:5-15 Yang CM, Spielman AJ, D'Ambrosio P, Serizawa S, Nunes J, Birnbaum J: A single dose of melatonin prevents the phase delay associated with a delayed...

Ngày tải lên: 10/08/2014, 09:20

7 314 0
Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt

Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt

... Hospital, Yamadaoka, Suita, Osaka 565, Japan 2Research Institute for Microbial Diseases, Osaka University, Yamadaoka, Suita, Osaka 565, Japan Published: 22 May 1998 References Doebbeling BN, Stanely ... et al Critical Care 1998, 2:79 http://ccforum.com number of bacteria after hand-washing/the number of bacteria before hand-washing)] Values are calculated from raw data and expressed as mean ... Each value was analysed using Mann-Whitney (between two groups) or anlaysis of variance (ANOVA; among three groups) tests Statistical significance was considered at P < 0.05 The number of bacteria...

Ngày tải lên: 12/08/2014, 18:20

2 451 0
application of real coded genetic algorithm for ship hull surface fitting with a single non-uniform b-spline surface

application of real coded genetic algorithm for ship hull surface fitting with a single non-uniform b-spline surface

... Chiyokura and Kimura (1984) As a result, boundary interpolating patch has several drawbacks for modification a large number of small surfaces that are bonded together to create a larger surface 2.2 ... rectangular patches and triangular patches A flexible CAD system should perform a good quality of shape and an interactive manipulation The B-spline vertex point modification actually works with ... tolerance Fitting process is also expected that the surface is obtained in a reasonable way with high quality of shape Many previous researches approached to automated B-spline surface modeling mathematically...

Ngày tải lên: 13/11/2014, 08:18

113 521 1
Narrowband photon pairs from a cold atomic vapour for interfacing with a single atom

Narrowband photon pairs from a cold atomic vapour for interfacing with a single atom

... work with him and Sandako while doing HOM measurements Gleb, for always teasing me I still miss that Dzmitry, for his great ideas One can approach him anytime and any day and he is always ready ... transition and a counterpropagating weak, modulated probe beam acquires a phase shift when tuned across the atomic resonance The change in phase shift is measured with a fast photodetector (Hamamatsu ... available in the market 87 Rb is a naturally occurring isotope of Rubidium with atomic number 37 It has a natural abundance of 28%, mass of 86.9 amu with a nuclear spin I of 3/2 Rubidium has another...

Ngày tải lên: 09/09/2015, 08:15

124 299 0
Tài liệu Báo cáo khoa học: A selenium-containing single-chain abzyme with potent antioxidant activity docx

Tài liệu Báo cáo khoa học: A selenium-containing single-chain abzyme with potent antioxidant activity docx

... Shanghai Second Reagent Plant, Shanghai, China Cytochrome c was obtained from Tianjin Biochemical Plant (Tianjin, China) Hepes was from Fluka All other chemicals were of analytical grade Generation ... as chronic inflammation, cardiovascular disease, cancer and cataract Acknowledgements We are grateful to the Major State Basic Research Development Program (Grant no G2000078102) and the High Technology ... reaction was completed The absorbance intensity at this time was recorded as A1 The plot of ln(At ) A1 ) vs time was made The absolute value of the line slope, Kapp, was the apparent rate constant...

Ngày tải lên: 21/02/2014, 00:20

6 400 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 18/06/2014, 22:20

10 541 0
báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf

báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 20/06/2014, 04:20

10 401 0
Báo cáo khoa học: "Elimination of Mange Mites Sarcoptes scabiei var. suis from Two Naturally Infested Danish Sow Herds Using a Single Injection Regime with Doramectin" pdf

Báo cáo khoa học: "Elimination of Mange Mites Sarcoptes scabiei var. suis from Two Naturally Infested Danish Sow Herds Using a Single Injection Regime with Doramectin" pdf

... body Animals were restrained, and the area was scraped with a sharp spoon until blood was visible The material obtained from the scraped area was transferred into a Vacutainer® glass tube labelled ... an SPF programme like the Danish system, (which has an extremely high guarantee of mange-free status) not be available, a quarantine facility must be used and managed on an all-in, all-out basis ... days of age Housing: Gestation and mating areas, as well as farrowing pens, had slatted flooring Pregnant sows were kept in stalls Pigs were weaned into a climate-controlled 2-stage weaning accommodation,...

Ngày tải lên: 12/08/2014, 15:20

10 260 0
Báo cáo y học: " Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants" docx

Báo cáo y học: " Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants" docx

... Kaleebu, J Mugisha, U Bahemuka, F Lyagoba, P Tabuga) Spain: Hospital Clinic-IDIBAPS Univ of Barcelona Barcelona (J M Miro, M López-Dieguez, F Agüero, JA Arnaiz, T Pumarola, M Plana, M Tuset, MC ... K, Frater J, Matthews P, Payne R, Addo M, Gatanaga H, Fujiwara M, Hachiya A, Koizumi H, et al: Adaptation of HIV-1 to human leukocyte antigen class I Nature 2009, 458:641-645 Gaschen B, Taylor ... of remaining plasma RNA was then extracted with the QIAamp Viral RNA Minikit (Qiagen, UK) according to the manufacturer’s instructions Single genome amplification (SGA) of env was carried as described...

Ngày tải lên: 13/08/2014, 01:21

14 360 0
Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"

Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"

... al Polytriazoles as copper(I)-stabilizing ligands in catalysis Organic Letters 2004; 6: 2853-5 Bock VD, Hiemstra H, van Maarseveen JH Cu-I-catalyzed alkyne-azide "click" cycloadditions from a ... chemistry can extend the ligation methods of functional molecules or genetic materials as a cargo to carrier and address-molecules to realize high local concentrations of active substances and is able ... reaction times and additionally stringent conditions like high temperatures Using the catalytically accelerated reaction variant introduced by Sharpless, only few hours at room temperature are...

Ngày tải lên: 26/10/2012, 09:39

10 623 0
Tài liệu Using Transactions with a DataSet (SQL) pptx

Tài liệu Using Transactions with a DataSet (SQL) pptx

... You can push these changes to the database using the following example: mySqlDataAdapter.Update(myDataSet); All your changes to myDataSet are pushed to the database as part of the transaction ... Each of the Command objects in mySqlDataAdapter will now use mySqlTransaction Let's say you added, modified, and removed some rows from a DataTable contained in a DataSet named myDataSet ... mySqlTransaction Note A transaction is rolled back by default; therefore, you should always explicitly commit or roll back your transaction using Commit() or Rollback() to make it clear what your...

Ngày tải lên: 24/12/2013, 01:17

2 394 0
Tài liệu Using a Transaction with a DataAdapter pptx

Tài liệu Using a Transaction with a DataAdapter pptx

... System.EventArgs e) { // Refresh the orders data dt.Clear( ); da.Fill(dt); } Discussion You can use a transaction with a DataAdapter to allow the roll back of updates made by the DataAdapter in ... private const String ORDERS_TABLE = "Orders"; private DataTable dt; private SqlDataAdapter da; private SqlCommandBuilder cb; // private void TransactionDataAdapterForm_Load(object sender, ... da.SelectCommand.Transaction = tran; If custom update logic is used for the DataAdapter, the Transaction must be associated with the DeleteCommand, InsertCommand, and UpdateCommand of the DataAdapter,...

Ngày tải lên: 21/01/2014, 11:20

4 281 0
Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf

Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf

... schema and data for the table da.FillSchema(ds, SchemaType.Source, TABLENAME); da.Fill(ds, TABLENAME); // Columns in XML representation of data as attributes foreach(DataColumn col in ds.Tables[TABLENAME].Columns) ... System.EventArgs e) { ds = new DataSet( ); // Create the DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME, ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Load ... SP0811_Update is called to update the database with the batched changes Example 8-16 Stored procedure: SP0811_Update ALTER PROC SP0811_Update @data ntext = null, @datadelete ntext = null AS DECLARE...

Ngày tải lên: 21/01/2014, 11:20

7 442 0
Tài liệu Báo cáo khoa học: "Joint Word Segmentation and POS Tagging using a Single Perceptron" docx

Tài liệu Báo cáo khoa học: "Joint Word Segmentation and POS Tagging using a Single Perceptron" docx

... character) tag t on a word starting with char c0 and containing char c tag t on a word ending with char c0 and containing char c tag t on a word containing repeated char cc tag t on a word starting with ... segmentation alone (Zhang and Clark, 2007), even with an agenda size as small as 8, and a simple beam search algorithm also works well for POS tagging (Ratnaparkhi, 1996) However, when applied ... Barcelona, Spain Adwait Ratnaparkhi 1996 A maximum entropy model for part-of-speech tagging In Proceedings of the EMNLP Conference, pages 133–142, Philadelphia, PA Murat Saraclar and Brian Roark...

Ngày tải lên: 20/02/2014, 09:20

9 576 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

... anesthesia activity index (OAAI) The majority of anesthesia workload in the labor ward comprises epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data ... cesarean anesthesia to the total OAAI in individual hospitals Data for 2005 (left) and 2007 (right) The OAAI correlated with epidural rates and cesarean rates more closely than did the annual ... the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per yr *0.75) (2) Statistical methods Quantitative variables are...

Ngày tải lên: 05/03/2014, 15:20

14 610 0
Báo cáo khoa học: "A TRANSFER MODEL USING A TYPED FEATURE STRUCTURE REWRITING SYSTEM WITH INHERITANCE" pot

Báo cáo khoa học: "A TRANSFER MODEL USING A TYPED FEATURE STRUCTURE REWRITING SYSTEM WITH INHERITANCE" pot

... produced after transfer, and make appropriate pragmatic decisions RELATING SURFACE AND ABSTRACT SPEECH ACTS A problem in translating dialogues is to translate adequately the speaker's communicative ... English 2a~ Aarld new PROP symbols in the translate.act, txans-speaker and trans-hearer slots [japanese: JASA [speech-act-type: #sat~EQUEST, manner: #man=DIRECT, speaker: # j-sp-J-SPEAK~ hearer: ... propositional content has (I) a lexical head, (2) a set of syntactic featur~ (such as tense-aspect-modality, determination, gender and may have (3) a set of ), dependents which are analyzed as case...

Ngày tải lên: 17/03/2014, 20:20

6 264 0
Báo cáo khoa học: Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase⁄reductase with a retinaldehyde reductase activity pdf

Báo cáo khoa học: Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase⁄reductase with a retinaldehyde reductase activity pdf

... greater catalytic efficiency as a reductase than as a dehydrogenase The catalytic efficiency of RDH13 as a retinaldehyde reductase is significantly lower than that of a related protein RDH11, primarily ... all-trans-retinaldehyde and appeared to prefer NADPH to NADH as a cofactor, because the conversion of lm all-trans-retinaldehyde in the presence of mm NADPH was about 20-fold greater than that ... incubated at 28 °C for 3–4 days The mitochondrial fraction was isolated as described above, and then solubilized with 15 mm DHPC (Avanti Polar Lipids, Alabaster, AL, USA) in a buffer containing...

Ngày tải lên: 23/03/2014, 07:20

10 674 0
w