... microbial resistance; and (b) the design of potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed ... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... were purchased from Avanti Polar Lipids (Alabaster, AL, USA) FITC-Ds were purchased from Sigma All other chemicals were reagent grade For antimicrobial assays, the commercially available quality...
Ngày tải lên: 16/03/2014, 00:20
... pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢ b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢ c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ and 5¢-T ... 513 bp containing the transmembrane domain: 5¢-CATCC ATAGCAGATAACAGTC-3¢ (forward) and 5¢-TCCCA AAGCTCATGTCATAAG-3¢ (reverse) corresponding to amino-acid residues S(123)SIADNSL(130) and P(287)YD ... Prostatea Small intestinea Spleena Testisa Thymusa Bone marrowa Fetal livera Lymph nodea Tonsila Breastb Lungb Milk cellsa Bovine Mammary glandc Mammary glandc Lungc Lymph nodec a Template MUC15...
Ngày tải lên: 24/03/2014, 04:21
Cell Membrane: The Red Blood Cell as a Model ppt
... T., Kanzaki, A. , Kaku, M., Yawata, A. , Takezono, M., Okamoto, N., Wada, H., Sugihara, T., Yamada, O., Katayama, Y., Nagata, N., Yawata, Y (1998) Homozygous missense mutation (band Fukuoka: G130R): ... Mayumi Kaku, Masami Uno (Takezono), Kenichiro Yata, Hidekazu Nakanishi, Yoshimasa Suetsugu, Makoto Mikami, Takayuki Tsujioka, and Shinichiro Suemori, Ms Mayumi Aizawa (Takahara), Chie Kawasaki ... Togawa, Shunsuke Koresawa, Sumire Hasegawa, Yoshinobu Takemoto, Masahiro Yoshimoto, Kazuyuki Mitani, Kosuke Miyashima, Masakiyo Mannoji, Takashi Sugihara, Nobumasa Inoue, Masaoo Shimoda, Akio Kanzaki,...
Ngày tải lên: 29/06/2014, 11:20
báo cáo khoa học: "SMI of Bcl-2 TW-37 is active across a spectrum of B-cell tumors irrespective of their proliferative and differentiation status" pptx
... and anti β-actin sure of fresh lymphoma cells and established cell lines to TW-37 was associated with activation of caspase and 9, cleavage of the polyadenosine ribose polymerase (PARP) into active ... overall project direction; YS technical work; ASG data interpretation; ASA technical work; BC data interpretation; AA technical work; RMM design of research experiments, data analysis All authors ... of treatment using Caspase-Glo3/7 Assay and Caspase-Glo Assay kit (Promega, Madison, WI) Assay procedure was done following manufacture's instruction using culture media without cells as blank...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo khoa học: " Electrolyte Composition of Mink (Mustela vison) Erythrocytes and Active Cation Transporters of the Cell Membrane" ppt
... whereas the intracellular concentration of Na+ is nearly as high as the extracellular one A significant difference in Na+ concentrations intra- and extracellularly may, however, exist, at least according ... Ca2+-activated ATPase (PM-Ca2+ATPase) Materials and methods Preparation of plasma, red cell contents and erythrocyte plasma membranes Domestic mink (Mustela vison) from a fur research farm free ... hydrolytic activities of the erythrocyte membrane fraction were measured as the calmodulin-activated Ca2+-ATPase and as the ATP-activated Ca2+pNPPase activity As also seen from Table no significant increase...
Ngày tải lên: 12/08/2014, 15:20
Interaction of polymeric nanoparticles with a model cell membrane a langmuir film balance technique
... Hydrodynamic-pressure-activated Hydration-activated Vapor-pressure-activated Mechanically activated Magnetically activated Ultrasound-activated Electrically activated Chemically activated DDSs pH-activated Ion-activated Hydrolysis-activated ... Surface tension of a monolayer γw Surface tension of water A Area occupied by the particles in the monolayer A0 Co-area of a particle AH Area occupied by the particles when they are hexagonally ... [2] It is a collective name for nanocapsules and nanospheres Nanocapsules are made up of an oily core (containing the drug) encapsulated by a membrane wall while nanospheres have a matrix-like...
Ngày tải lên: 08/11/2015, 16:31
Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"
... human gastric cancer cell line (AGS) before and after CKBM treatment using Western blot analysis Materials and Methods Cell culture Human gastric cancer cell line (AGS) was obtained from American ... demonstrated that CKBM is able to inhibit cell proliferation in human gastric cancer cell line, AGS The data from a subcutaneous implantation model of gastric cancer tissue was also agreeable to ... purchased from Amersham (Uppsala, Sweden) and it was performed according to the kit manual Analysis of cell cycle progression Cells were seeded in a 25 cm2 flask at a density of x 106 cells/flask...
Ngày tải lên: 02/11/2012, 11:12
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
... kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a ... times a week Membrane fluidity measurements The plasma membrane fraction of K562 cells was isolated according to Maeda et al [44] Isolated plasma membranes were labeled in 10 mm Tris, 10 mm NaCl ... heat-induced plasma membrane fluidization, are indeed capable of activating HSP formation even at the growth temperature, without causing measurable protein denaturation We also demonstrate that,...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Biochemical characterization of human umbilical vein endothelial cell membrane bound acetylcholinesterase ppt
... biochemical and histochemical characterization of human non-neuronal AChE in several types of cells, such as epithelial cells (airways, alimentary tract, urogenital tract, epidermis), mesothelial cells ... protein interaction, may modulate several cellular signaling pathways Non-neuronal ACh appears to regulate different cellular functions such as proliferation, differentiation, cell cell contact, immune ... Thesis, Faculdade de Ciencias e Tecnologia da Universiˆ dade Nova de Lisboa, Portugal 22 Tayebati SK, El-assouad D, Ricci A & Amenta F (2002) Immunochemical and immunocytochemical characterization...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: Structures and mode of membrane interaction of a short a helical lytic peptide and its diastereomer determined by NMR, FTIR, and fluorescence spectroscopy pdf
... not a prerequisite for maintaining an interface localization of a peptide In summary, the structural and functional analyses of the all-L-amino acids peptide and its diastereomeric analog indicate ... Optics Laboratory Co., Tokyo, Japan) as follows A drop of vesicles was deposited on a carbon-coated grid and negatively stained with uranyl acetate Examination of the grids revealed that the vesicles ... organization and interface location The structural analysis presented here reveals that both peptides adopt amphipathic organization within the membrane In a previous study it was shown that the antimicrobial...
Ngày tải lên: 17/03/2014, 11:20
Báo cáo khoa học: Membrane targeting of a folded and cofactor-containing protein potx
... formation of the mutant protein For the in vivo analyses, the RRfiKK exchange was achieved using the primers 5¢-CATCACTTTGACAGCGTCTTTCTTGCTC TTGCTGATTGGCTTATCG-3¢ and 5¢-CGATAAGCCA ATCAGCAAGAGCAAGAAAGACGCTGTCAAAGTG ... 5¢-AAGAGC AAGAAAGACGCTGTCAAAGTGATG-3¢/5¢-TCCGG ATATAGTTCCTCCT-3¢ and 5¢-ACGTTACTGGTTTC ACATTC-3¢/5¢-AGCGTCTTTCTTGCTCTTGCTGATT GGCTT-3¢ to generate two overlapping PCR fragments with pEXH5 as template ... dithiothreitol Aggregated material was removed by a final centrifugation at 15 000 g, and the clear supernatant was divided into aliquots and frozen in liquid nitrogen Cofactor tracing and membrane- targeting...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo khoa học: Bilayer localization of membrane-active peptides studied in biomimetic vesicles by visible and fluorescence spectroscopies pptx
... Gram-negative bacteria [14,15] Previous studies have pointed to a preferred localization of magainin at membrane surfaces [5,16,17] Melittin is a widely studied helical cationic peptide that ... binding assay An ultracentrifugation binding assay was carried out for evaluating peptide affinities to the vesicles (partition coefficients [29,40]), in order to obtain an accurate comparison of ... (ÔblueÕ and ÔredÕ refer to the visual appearance of the material, not actual absorbance) PB0 is the blue/red ratio of the control sample before induction of a color change, and PBI is the value obtained...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo Y học: Proliferating cell nuclear antigen from a basidiomycete, Coprinus cinereus Alternative truncation and expression at meiosis pptx
... a pI of 4.5 [34] and a calculated molecular mass of 28.8 kDa, and that ran as an approximately 36-kDa protein on SDS/PAGE, CoPCNA -a and CoPCNA-b might behave in a manner similar to human PCNA ... to amino-acid motifs conserved in human PCNA, Schizosaccharomyces pombe PCNA, Drosophila melanogaster PCNA and Arabidopsis thaliana PCNA: sense primer (5¢-CCGGCATCAACCTGCARDSNATG GA-3¢) and antisense ... truncating sites in the CoPCNA gene are summarized in Fig 4B,C CoPCNA-b mRNA appeared to be produced from the CoPCNA -a mRNA by truncation at speci®c sites; i.e 5¢-AAGAAGGAGAAG-3¢ and 5¢-GA AGAGGAAGAA-3¢...
Ngày tải lên: 31/03/2014, 15:20
báo cáo hóa học: " Serum antibodies from Parkinson''''s disease patients react with neuronal membrane proteins from a mouse " ppt
... PBS, washed again, and then sera was added at a 1:100 dilution in 20% normal goat serum in PBS Plates were again washed, and alkaline-phosphatase-conjugated goat anti-human IgG (H + L) (Jackson ... r2 value was assessed by linear regression analysis (SigmaPlot 2000) and the significance (p) was calculated by Pearson correlation analysis with SigmaStat (Jandel Corp) microglia and 1% human ... differentiated cells compared to undifferentiated cells, again peaking at Day and eventually dropping until the level was similar to that seen in undifferentiated cells by Day This data shows that differentiated...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo hóa học: " Respiratory function and bronchial responsiveness among industrial workers exposed to different classes of occupational agents: a study from Algeria" potx
... to moderate physical activity; symptoms suggesting asthma or allergy, the use of medication for asthma or allergy, and the presence of hay-fever and nasal allergies Asthma was defined as answering ... Environmental and Occupational Health Assembly, American Thoracic Society: American Thoracic Society Statement: Occupational contribution to the burden of airway disease Am J Respir Crit Care Med ... limitations Observational studies cannot prove causation Occupational health remains limited in Northern Africa because of competing social, economic, and political challenges Although no quantified...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo y học: "Depression, osteoporosis, serotonin and cell membrane viscosity between biology and philosophical anthropology" docx
... Lucia A, Amato P: Platelet and brain fatty acids: a model for the classifcation of the animals? Part Int J Anthropology 2009, 24:69-76 Cocchi M, Tonello L, De Lucia A, Amato P: Platelet and brain ... of arachidonic acid from platelets and brain and vice versa, we have shown that when platelets are saturated with arachidonic acid this exchange is no longer possible [13,14] and the two areas ... brain fatty acids: a model for the classification of the animals? Part Platelet and brain fatty acid transfer: hypothesis on arachidonic acid and its relationship to major depression Int J Anthropology...
Ngày tải lên: 09/08/2014, 01:21
báo cáo khoa học: "Odontogenic tumors and giant cell lesions of jaws - a nine year study" docx
... oral and maxillofacial tumors in children Oral Surg Oral Med Oral Path Oral Radiol 1999, 88:11-15 Sato M, Tanaka N, Amagasa T: Oral and maxillofacial tumors in children: a review Br J Oral Maxillofac ... Jordanian children and adolescents: a retrospective analysis over 10 years Int J Oral Maxillofac Surg 2003, 32:78-83 Tanaka N, Murata A, Yamaguchi A, Kohama G: Clinical features and management ... Mosqueda et al [17], AlKhateeb [21], Tanaka [22] and Sato [23] This finding proves that ameloblastomas are more commomly encountered tumors in Asians and Africans compared to Caucasians Ameloblastomas...
Ngày tải lên: 09/08/2014, 02:20
Báo cáo khoa học: "Solitary colonic metastasis from renal cell carcinoma presenting as a surgical emergency nine years post-nephrectomy" pot
... G, Uludag M, Ozagari A: Solitary colonic metastasis of renal cell carcinoma Acta Chirurgica Belgica 2008, 108(2):264-5 Kradjian RM, Bennington JL: Renal cell carcinoma recurrence 31 years after ... GS, Gupta K, Bhandari RK: Case report: Renal cell carcinoma: Unusual metastases Indian J Radiol Imaging 2000, 10:249-51 Tanis PJ, van der Gaag NA, Busch OR, van Gulik TM, Gouma DJ: Systematic review ... 1996, 3(6):501-3 Uchida K, Miyao N, Masumori N, Takahashi A, Oda T, Yanase M, Kitamura H, Itoh N, Sato M, Tsukamoto T: Recurrence of renal cell carcinoma more than years after nephrectomy Int...
Ngày tải lên: 09/08/2014, 03:21
Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf
... (Annexin-V-positive/PI-positive) cells was determined in the CD4-positive and CD8-positive subpopulations, using two-dimensional dot blots and appropriate gates Evaluation of basal and stimulated intracellular cAMP Basal and ... statistical analysis, supported figure preparation, and helped with manuscript preparation UW participated in patient recruitment, statistical analysis, and manuscript preparation HH participated in ... pathway J Biol Chem 2000, 275:20726-20733 50 Nakamura A, Johns EJ, Imaizumi A, Yanagawa Y, Kohsaka T: Modulation of interleukin-6 by β2-adrenoceptor in endotoxin-stimulated renal macrophage cells...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "proteomic characterization of non-small cell lung cancer in a comprehensive translational thoracic oncology database" docx
... facilitate translational research A major limitation to conducting translational research is that basic science and clinical data are often stored in different databases [2] This makes it challenging ... for each patient with TMA data within the database An averaged protein expression score was calculated for all available normal and tumor samples for each patient (i.e., replicates of the same ... therapeutics and decision making Biomark Med 2008, 2:577 Jagadeeswaran R, Surawska H, Krishnaswamy S, Janamanchi V, Mackinnon AC, Seiwert TY, Loganathan S, Kanteti R, Reichman T, Nallasura V, Schwartz...
Ngày tải lên: 10/08/2014, 09:22