cd8 t cell responses during acute early hiv infection

Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx

Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx

... detected positive responses Number of detected positive responses (A) The histogram plots show the number of positive CD8, CD4 or total T- cell responses detected with the IFN-γ+ MIP-1β+ and the ... evaluation equivalent to the measurement of the total IFN-γ producing T- cells with the relevant advantage of a consistent decrease of the background that in turn increases the sensitivity of the ... reports demonstrated that the ELISPOT assay is more sensitive in detecting weak responses when compared to the ICS assay [8-11], a feature that represents an important advantage for the detection...

Ngày tải lên: 10/08/2014, 05:21

13 379 0
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf

báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf

... Acknowledgements This project was supported by the Institutional Research Program of the Texas Tech University Health Sciences Center, the Southwest Cancer Treatment and Research Center Program, the Laura ... into DCs could elicit a significant CTL response against IE1-positive target cell lines This was the first time that the gene encoding IE1 was inserted into the AAV vector First, the IE1 gene was ... stimulated AAV/IE1-specific CTLs We analyzed the ability of the AAV/IE1 vectors to generate IE1 specific-CTLs (optimal ratio E :T; 1:20) To analyze CTL activity, we used the following target cell...

Ngày tải lên: 18/06/2014, 15:20

8 452 0
Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc

Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc

... also of interest as potential vaccine antigens because they appear at the start of a replicative cycle and responses to them could act early in infection VP22 is a structural antigen that is expressed ... and to identify responses to known EBV and HSV-2 CD8 epitopes, indicates the results are measures of authentic CD8 responses Although it appeared that the length of peptide was not optimal for CD8 ... suggests that even with few or no recurrences the immune system is being exposed to virus antigen The strength of the responses would argue that the virus may be continually attempting to reactivate...

Ngày tải lên: 20/06/2014, 01:20

15 329 0
Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf

Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf

... Measurement of the functional avidity of CD8+ T cell responses The functional avidity of CD8+ T cell responses at sequential time-points during the first year of HIV infection was determined by peptide-titrated ... following presentation with HIV infection For epitopes in patients, PBMC from selected time-points during the first year following presentation with HIV infection were titrated against index sequence ... occurred in acute and early HIV infection, to gain insight into the potential impact of these two mechanisms on T cell- mediated containment of virus replication at this time Sequence variation and...

Ngày tải lên: 13/08/2014, 01:20

13 370 0
Báo cáo y học: "Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor" ppt

Báo cáo y học: "Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor" ppt

... to wild type TW10 peptide, but not to autologous variants Representative dot plot and histogram shown for stimulation with one of the autologous mutants, TSTLTEQVAW (top left) and wild type TW10 ... infected PHA activated CD4 +T cells from ES8 with the replication competent viruses constructed to express these TW10 variants, and co-cultured the infected cells with each CD8+ T cell population that ... that had been stimulated with the four peptides, or with unstimulated CD8 + T cells As shown in Figure 4a, CD8+ T cells that were not pre-incubated with HIV peptides were as efficient as CD8+ T cells...

Ngày tải lên: 13/08/2014, 01:21

7 273 0
Immunodominance and immunoprotection of anti viral specific CD8+ t cell response during HBV infection

Immunodominance and immunoprotection of anti viral specific CD8+ t cell response during HBV infection

... while patients who resolve the infection often experience acute hepatitis 20 This led to the suggestion that the ability of the innate immunity to produce large amounts of IFN-γ or Th1 cytokines ... surprisingly, the little stimulatory efficiency of HLA-A203+ targets was completely lost after the 12 h dissociation period (Figure 7) It is interesting to note that the peptide presentation data recapitulate ... multi-specific CD8 T- cells with the absence of CD4 T- cells 38 This suggests that the absence of CD4 cytokine help prevented the proper maturation and subsequent functioning of the CD8 T- cells...

Ngày tải lên: 10/09/2015, 08:26

108 336 0
The role of interferon gamma in regulating antigen specific CD8 t cell responses in a mouse model of influenza

The role of interferon gamma in regulating antigen specific CD8 t cell responses in a mouse model of influenza

... influenza infection is to provide T cell help to augment B cell antibody production and CD8+ T cell cytolysis of infected cells to clear the virus from the respiratory tract Different subsets of Th cells ... HA is a lectin that mediates the binding of the virus to target cells and facilitates the entry of the virus into the target cell The proteolytic cleavage of the HA molecule (HA0) into HA1 and ... infection, CD8+ T cells are activated in the lung draining lymph nodes and are recruited to the site of infection CD8+ T cells have several effector functions that lead to their antiviral activity...

Ngày tải lên: 10/09/2015, 09:25

263 427 0
Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc

Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc

... However, little is known about the change of CD8+ cell subsets during early period of ART In this study we investigated the dynamic changes not only in CD8+ cell subsets, but also in their activation ... after ART Activation of CD8+ cell subsets We next investigated the effect of ART on T cell activation HIV- infected individuals had higher T- cell activation in the blood as indicated by expression ... et al.: Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART AIDS Research and Therapy 2011 8:15 Submit your next manuscript to BioMed Central...

Ngày tải lên: 10/08/2014, 05:22

7 338 0
Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot

Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot

... attenuates the response (top) The newly proposed model puts together new insights into CTLA-4 functions (bottom) (1) During suboptimal T cell activation, CTLA-4 sets the threshold for activation ... target cells; on the other, blockade of CTLA-4 abrogates the inhibitory function of Treg cells [72] Interestingly, naive T cells, converted to Treg cells by retroviral transduction with the transcription ... suggesting that the gene transcription of activated T cells, rather than the regulation of proteins, is altered by CTLA-4 It is not yet clear whether CTLA-4 interferes with CD28 costimulation...

Ngày tải lên: 09/08/2014, 01:23

10 393 0
Báo cáo y học: "Mycobacterial immune reconstitution inflammatory syndrome in HIV-1 infection after antiretroviral therapy is associated with deregulated specific T-cell responses: Beneficial effect of IL-2 and GM-CSF immunotherapy" pptx

Báo cáo y học: "Mycobacterial immune reconstitution inflammatory syndrome in HIV-1 infection after antiretroviral therapy is associated with deregulated specific T-cell responses: Beneficial effect of IL-2 and GM-CSF immunotherapy" pptx

... patients Patient CD4 T cell count before ART cells/µl CD4 T cell count at presentation of IRIS cells/µl Fold change in CD4 T cell counts from baseline to IRIS presentation CD4 T cell count after ... seronegative individuals, and after therapeutic vaccination of asymptomatic patients [8-10] It has been postulated that after treatment of late-stage HIV- 1 infection, recovery and augmentation of ... possibly reflect thymic dysfunction/inactivity Our data suggests that the degree of immune reconstitution achieved with potent ART alone is dependent on the clinical stage of the patient when therapy...

Ngày tải lên: 11/08/2014, 10:23

11 365 0
Báo cáo y học: "Effects of recombinant human growth hormone on HIV-1-specific T-cell responses, thymic output and proviral DNA in patients on HAART: 48-week follow-up" ppt

Báo cáo y học: "Effects of recombinant human growth hormone on HIV-1-specific T-cell responses, thymic output and proviral DNA in patients on HAART: 48-week follow-up" ppt

... rhGH treatment promotes the restoration of Tcell responses against HIV- 1, a restoration that declines with cessation of treatment Since HIV- 1+ patients commonly develop growth hormone abnormalities, ... after by CD8+ T cells IFN-γ productionrhGH therapy in response to rVV HIV- 1 constructs and peptide pools in HAART treated HIV+ patients IFN-γ production by CD8+ T cells in response to rVV HIV- 1 ... our data have important implications for the treatment of HIV- 1, and raise the possibility that rhGH may form part of an immune-based therapeutic programme tailored to the treatment of HIV- 1...

Ngày tải lên: 11/08/2014, 10:23

13 359 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

... muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8 PSMB2 NM_002794.3 proteasome subunit, beta type, PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga ... V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 Wu et al Retrovirology ... killer cell lectin-like receptor subfamily D, member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt...

Ngày tải lên: 13/08/2014, 01:20

21 376 0
Báo cáo sinh học: " A combined nucleocapsid vaccine induces vigorous SARS-CD8+ T-cell immune responses" potx

Báo cáo sinh học: " A combined nucleocapsid vaccine induces vigorous SARS-CD8+ T-cell immune responses" potx

... 5'-ggatccatgtctgataatggaccc-3'; reverse primer: 5'-gaattcttatgcctgagttgaatc-3') The amplicon was purified using the QIAquick gel extraction kit (Qiagen) and cloned into the PCR 2.1 TOPO-TA vector ... neither the mock-transfected cells nor the cells transfected with the vector alone showed viral-like particles (Fig 2) These observations demonstrate that our construct expressing the NC protein ... most frequently used experimental adjuvants; this adjuvant stimulates dendritic cells through Toll-like receptor (TLR9), inducing cell maturation and enhancing antigen presentation and Th1 responses...

Ngày tải lên: 14/08/2014, 19:22

10 161 0
Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot

Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot

... differentiated effector T cells, but unlike conventional effectors [22], the CD45RA+ CD8 T cells noted after anti-CD3 treatment were consistently CD27+ (Figure 3) and CD57- (data not shown) Effector ... matched control cells also often expanded as well To distinguish true restimulation-dependent growth from persistent expansion still attributable to primary stimulation, we calculated the ratio ... stimulated cells/expansion by matched control cells and plotted this as a function of the time interval between first and second stimulation (Figure 8A-D) These plots make two important points...

Ngày tải lên: 18/06/2014, 16:20

15 503 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

... deleterious anti-vector immunity The priming strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically useful effector T cells ... Proliferation during antigen-recall Treatment with ctrl Ig Treatment with PD-1-blocking Ig DNA (Plasmid) Peptide without CpG adjuvant Figure The responsiveness of CD8+ T cells is “imprinted” during the ... antigen exposure and other factors •Limited antigen exposure, with potent co-stimulation could lead to T cells that retain low PD-1 expression through various stages: recently activated, effector...

Ngày tải lên: 18/06/2014, 16:20

11 506 0
Báo cáo sinh học: "Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" doc

Báo cáo sinh học: "Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" doc

... regulated concomitantly, indicating a differential intra-cluster regulation in agreement with the TLDA results (Table 1) Altogether, the data presented here demonstrate for the first time that human ... properties In that respect, it might therefore be helpful to elaborate better vaccination strategies for induction of CD8 + T cells with appropriate differentiation and functions Acknowledgements The ... role in CD8+ T cells remains an interesting issue to investigate, as it might shed new light on the relationship between cytokine signaling and lymphocytes differentiation In contrast to the clear...

Ngày tải lên: 18/06/2014, 19:20

8 399 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

... residence of the cells Therefore, the conclusion that RSV infection specifically impairs CD8+ CTL functionality [1], and the hypothesis that this might contribute to RSV re -infection, must be reassessed ... tetramer +CD8+ T cell response (23% of total CD8+ cells) was detected in the lungs (Table 1) A somewhat lower response (15%) of tetramer +CD8+ cells was detected in the lungs after IN infection with ... respiratory tract infection, since it was also observed in lung CD8+ CTL that migrated from the site of a localized dermal infection with VV-M2 Fourth, the CD8+ CTL impairment observed in the study...

Ngày tải lên: 20/06/2014, 01:20

8 381 0
báo cáo hóa học:" Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" pptx

báo cáo hóa học:" Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" pptx

... regulated concomitantly, indicating a differential intra-cluster regulation in agreement with the TLDA results (Table 1) Altogether, the data presented here demonstrate for the first time that human ... properties In that respect, it might therefore be helpful to elaborate better vaccination strategies for induction of CD8 + T cells with appropriate differentiation and functions Acknowledgements The ... role in CD8+ T cells remains an interesting issue to investigate, as it might shed new light on the relationship between cytokine signaling and lymphocytes differentiation In contrast to the clear...

Ngày tải lên: 20/06/2014, 03:20

8 326 0
Báo cáo y học: "Frequency analysis of TRBV subfamily sjTRECs to characterize T-cell reconstitution in acute leukemia patients after allogeneic hematopoietic stem cell transplantation" pot

Báo cáo y học: "Frequency analysis of TRBV subfamily sjTRECs to characterize T-cell reconstitution in acute leukemia patients after allogeneic hematopoietic stem cell transplantation" pot

... sjTRECs and TRBV-BD sjTRECs to evaluate not only the recent total naïve T- cell output but also the specific TRBV subfamily naïve T- cell output from the thymus in patients after HSCT The sjTRECs ... important factor determining the success of immune reconstitution post-HSCT and whether thymicdependent or -independent pathways contribute to Tcell reconstitution post-HSCT Thymic function and ... developmental proximity to the thymus and their concentrations in peripheral blood can be used to estimate thymic output and evaluate thymic function in patients after stem cell transplantation Graft-versus-host...

Ngày tải lên: 10/08/2014, 21:23

8 345 0
Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

Báo cáo y học: "IMP321 (sLAG-3), an immunopotentiator for T cell responses against a HBsAg antigen in healthy adults: a single blind randomised controlled phase I study" ppt

... addition to the TLR agonists that are innate immunity ligands, the immune response involves two adaptive immunity ligands that are expressed on activated T cells and bind to non-TLR receptors ... that, even at this early time point, both IMP321 recipients who had seroconverted after the second immunization in the μg group had attained seroprotective titers Following the third immunization, ... Engerix Induction of CD8+ Tc1 cell responses to HBsAg peptides Figure Induction of CD8+ Tc1 cell responses to HBsAg peptides Unstimulated and HBsAg peptides-stimulated PBMC were stained with fluorochrome-conjugated...

Ngày tải lên: 11/08/2014, 10:23

15 330 0
w