cd8 t cell responses after priming in the absence of tregs

Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx

Báo cáo y học: " The intracellular detection of MIP-1beta enhances the capacity to detect IFN-gamma mediated HIV-1-specific CD8 T-cell responses in a flow cytometric setting pro" ppsx

... modality of evaluation equivalent to the measurement of the total IFN-γ producing T- cells with the relevant advantage of a consistent decrease of the background that in turn increases the sensitivity ... represent an interesting option to increase the sensitivity of the ICS assay in the detection of IFN-γ mediated HIV-1-specific responses In order to compare the sensitivity of the two modalities to evaluate ... rare Since the analysis of the combination of two functions decreases the background and the measurement of the IFN-γ+ MIP-1β+ T- cells was equivalent to the measurement of the total IFN-γ+ T- cells,...

Ngày tải lên: 10/08/2014, 05:21

13 379 0
The role of interferon gamma in regulating antigen specific CD8 t cell responses in a mouse model of influenza

The role of interferon gamma in regulating antigen specific CD8 t cell responses in a mouse model of influenza

... glycoproteins on the surface of the virus HA is a lectin that mediates the binding of the virus to target cells and facilitates the entry of the virus into the target cell The proteolytic cleavage of ... encoding the matrix protein The M2 protein comprises of the ectodomain M2e, a small part exposed to the cell surface, a transmembrane domain with the rest of it localized within the internal portion ... crucial to viral clearance, the quantity of virus-specific cells generated is equally important in determining the outcome of infection Tetramer staining of CD8+ T cells reveals that there is a strong...

Ngày tải lên: 10/09/2015, 09:25

263 427 0
Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf

Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf

... mutation had been transmitted that then reverted, stimulating expansion of T cells able to recognise the original epitope with higher avidity than the initial response [35] In the other epitopes, ... positive Measurement of the functional avidity of CD8+ T cell responses The functional avidity of CD8+ T cell responses at sequential time-points during the first year of HIV infection was determined ... sequence of the epitope at the indicated timepoint (day (d) FOSx is shown Areas of amino acid variation within the epitope are indicated in bold italics and underlined the virus population within the...

Ngày tải lên: 13/08/2014, 01:20

13 370 0
Báo cáo y học: "Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor" ppt

Báo cáo y học: "Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor" ppt

... no mutations in either the IW9 or TW10 epitopes, suggesting that mutations in the HLA-B*57 restricted epitopes are not the only factors impacting the fitness of virus from ES8 To elucidate the ... them from the dominant proviral variants These plasma Gag clones were identical to each other with the exception of variation at the TW10 epitope In total, seven different variations in the TW10 ... variants Representative dot plot and histogram shown for stimulation with one of the autologous mutants, TSTLTEQVAW (top left) and wild type TW10 (top right) Gating is on CD8+ T cells (bottom) Total...

Ngày tải lên: 13/08/2014, 01:21

7 273 0
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf

báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf

... shown in Figures 4, 5, to be insignificant targets http://www.translational-medicine.com/content/6/1/56 Competing interests The authors declare that they have no competing interests Authors' contributions ... loading and a zero virus control (PBMC only) The cytotoxicity of the stimulated T- cells directly correlated with the amount of AAV/IE1 used to load the Figure Cytotoxicity assay Cytotoxicity assay ... loading DCs at day Alternately, the addition of anti-class I antibodies significantly inhibited the killing activity (P < 0.05), suggesting that CTLs were MHC class I restricted The CTL stimulation...

Ngày tải lên: 18/06/2014, 15:20

8 451 0
Báo cáo y học: "Collagen type II (CII)-specific antibodies induce arthritis in the absence of T or B cells but the arthritis progression is enhanced by CII-reactive T cells" ppsx

Báo cáo y học: "Collagen type II (CII)-specific antibodies induce arthritis in the absence of T or B cells but the arthritis progression is enhanced by CII-reactive T cells" ppsx

... significant R547 To investigate the role of T cells in the acute effector stage of clinical arthritis, newly activated T cells were injected into QD mice intravenously day after the antibody transfer ... different effect on the acute phase of arthritis However, T cells again did not affect the initiation phase of the disease; instead, the effect was noted in the more chronic phase of the disease Still, ... enhancement of arthritis in the T cell and B cell singly deficient mice also suggests that these cells might have regulatory roles in the initiation of disease by modulating the cytokine environment...

Ngày tải lên: 09/08/2014, 01:24

7 434 1
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

... aggccacatcctagttctgc GBP1R tccaggagtcattctggttgt BDLvsVIR CD8 -2.5 -2.4 ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 ... genes from the gene set TCA cycle within the ranked list Top, the running enrichment score for the gene set as the analysis walks along the ranked list The score at the peak of the plot is the enrichment ... pathways that segregated these cellular transcriptomes during disease progression were identified, suggesting that HIV also maintains distinct interaction with these cell types in vivo Detection of...

Ngày tải lên: 13/08/2014, 01:20

21 376 0
Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

... curcumin (I) on the interactions between the nucleotide binding domain (N) and the phosphorylation domain (P), to give competitive inhibition with respect to ATP into contact in the absence of ATP, ... curcumin is then able to bind to the ATPase (possibly at the hinge region) locking the two domains together and therefore precluding ATP binding (i.e inhibiting the ATPase in a ‘competitive manner’) ... the order of addition to the ATPase (i.e curcumin then ATP) had a similar effect on the extent of ATP binding, i.e in both cases, the amount of ATP binding to the ATPase was significantly decreased...

Ngày tải lên: 08/03/2014, 23:20

10 594 0
Báo cáo khoa học: Catalytic mechanism of the primary human prostaglandin F2asynthase, aldo-keto reductase 1B1 – prostaglandin D2 synthase activity in the absence of NADP(H) pptx

Báo cáo khoa học: Catalytic mechanism of the primary human prostaglandin F2asynthase, aldo-keto reductase 1B1 – prostaglandin D2 synthase activity in the absence of NADP(H) pptx

... higher than that of the wild-type AKR1B3 These results confirm that these mutations not affect significantly the overall three-dimensional structure of the cofactor-binding site within the catalytic ... A) demonstrated that the substrate PGH2 was bound to the substrate-binding cavity in an extended conformation at the top of the (a ⁄ b)8-barrel (Fig 4A,B) The docking calculation, including molecular ... conformation at the top of the a ⁄ b-barrel, with the nicotinamide ring projecting down into the center of the barrel and pyrophosphate straddling the barrel lip [7] Kubiseski et al [8] have established...

Ngày tải lên: 14/03/2014, 23:20

11 390 0
Báo cáo khóa học: Protein assembly of photosystem II and accumulation of subcomplexes in the absence of low molecular mass subunits PsbL and PsbJ pdf

Báo cáo khóa học: Protein assembly of photosystem II and accumulation of subcomplexes in the absence of low molecular mass subunits PsbL and PsbJ pdf

... with a terminator was also inserted into an EcoRV site, located in the 3¢ UTR of the operon, to generate the RV control plants The plasmid construct and the transformation, selection and culture ... on the other hand, represented a PSII LMM protein that was present at reduced amounts in the thylakoids of both DpsbE and DpsbF (33 ± 11 of that in the control thylakoids) To investigate the ... experimental conditions This indicates that, in the absence of PsbL, the assembly of CP43 and thus the formation of stable intact PSII core monomers is severely impaired None of the other PSII proteins...

Ngày tải lên: 30/03/2014, 13:20

12 401 0
Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx

Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx

... 0.08% and 0.13% of CD8+ T cells at the second time point (more than months after HCV clearance) The patient tested negative with the tetramer assay at the two other time points (both after HCV clearance) ... points proteins tested with at least positive/time point positive protein (mean number) Class I Tetramer Assay Time points with tetramers at least positive tested positive/ tetramer time point ... HCV-specific CD8+ T cell cells were found by tetramer staining in three of the four patients, although the frequencies of tetramer-positive cells were rather low in of them as they did not exceed 0.2% of...

Ngày tải lên: 18/06/2014, 18:20

11 528 0
Báo cáo hóa học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" potx

Báo cáo hóa học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" potx

... 0.08% and 0.13% of CD8+ T cells at the second time point (more than months after HCV clearance) The patient tested negative with the tetramer assay at the two other time points (both after HCV clearance) ... points proteins tested with at least positive/time point positive protein (mean number) Class I Tetramer Assay Time points with tetramers at least positive tested positive/ tetramer time point ... HCV-specific CD8+ T cell cells were found by tetramer staining in three of the four patients, although the frequencies of tetramer-positive cells were rather low in of them as they did not exceed 0.2% of...

Ngày tải lên: 20/06/2014, 01:20

11 440 0
Báo cáo khoa học: "Pancreatic insulinoma co-existing with gastric GIST in the absence of neurofibromatosis-1" pot

Báo cáo khoa học: "Pancreatic insulinoma co-existing with gastric GIST in the absence of neurofibromatosis-1" pot

... by the Editor -in- Chief of this journal Competing interests The authors declare that they have no competing interests Authors' contributions EA conceived and designed the report, analyzed all the ... Figure CT abdomen showing cystic recurrent GIST located in the region of the pancreatic tail CT abdomen showing cystic recurrent GIST located in the region of the pancreatic tail Page of (page ... concurrent tumours Available evidence suggests that mutations in the NF-1 gene might be involved in the pathogenesis of GIST in NF-1 patients [18] However it is unknown if the same mutation exists in...

Ngày tải lên: 09/08/2014, 04:21

5 457 0
Báo cáo y học: " Effector mechanisms of interleukin-17 in collagen-induced arthritis in the absence of interferon-γ and counteraction by interferon-γ" pot

Báo cáo y học: " Effector mechanisms of interleukin-17 in collagen-induced arthritis in the absence of interferon-γ and counteraction by interferon-γ" pot

... swelling (i.e 100 × the difference between the increase of thickness of the left and the right ears, divided by the thickness of the right ear) at the indicated time points Histograms represent ... with wild-type MEF For the inhibition of the expression of GCP-2, these results were confirmed at the protein level (Figure 6b) These data indicate that the inhibition by IFN-γ is STAT-1-, but ... mobilisation of neutrophils, and bone destruction, which are all important in joint inflammation Competing interests The authors declare that they have no competing interests Authors' contributions...

Ngày tải lên: 09/08/2014, 14:22

13 560 0
Báo cáo y học: "Candida albicans genome sequence: a platform for genomics in the absence of genetics" potx

Báo cáo y học: "Candida albicans genome sequence: a platform for genomics in the absence of genetics" potx

... matingcompetent strains [10,11] Further work led to the identification of a natural mating-competent form that mates naturally at high frequency to give a tetraploid gamete [12] So far, attempts ... therefore, that the present-day C albicans genome contains the information that enables this fungus to thrive in its human host in competition with the immune system and with other microflora There are ... important insights into the evolution of niche-specific functions related to pathogenesis in humans There are now more than forty fungal genomesequencing projects underway, including representatives...

Ngày tải lên: 09/08/2014, 20:20

3 400 0
Báo cáo y học: "Aspergillus antigen induces robust Th2 cytokine production, inflammation, airway hyperreactivity and fibrosis in the absence of MCP-1 or CCR2" pptx

Báo cáo y học: "Aspergillus antigen induces robust Th2 cytokine production, inflammation, airway hyperreactivity and fibrosis in the absence of MCP-1 or CCR2" pptx

... left lung was removed by cutting the left mainstem distal to the suture It was then frozen in liquid nitrogen and stored at -70°C until processed for hydroxyproline content The right lung was inflated ... CCR2-deficient mice had intact responses to allergen challenge This indicates that the lack of a requirement for CCR2 is not unique to a single asthma model It also highlights the difficulty in pinpointing ... CCR2 in eosinophil recruitment, robust inflammatory responses to Aspergillus antigen occurred even in the complete absence of either of these molecules In contrast to our results indicating a...

Ngày tải lên: 12/08/2014, 18:21

12 290 0
Bóa cáo y học: "The incidence and outcome of septic shock patients in the absence of early-goal directed therapy" pdf

Bóa cáo y học: "The incidence and outcome of septic shock patients in the absence of early-goal directed therapy" pdf

... even in the absence of EGDT; this information is important in that it may help to design planned multicentre trials of EGDT Competing interests The authors declare that they have no competing interests ... being transferred to the ICU Of the 17 patients admitted to the HDU, three were subsequently transferred to the ICU after being in the HDU for to 23 hours The mean HDU LOS for these 17 patients ... advantages might already be realized The intervention rates of central line insertion in 78% of patients, arterial cannulation in 72% of patients, and antibiotic administration in the first hours...

Ngày tải lên: 12/08/2014, 23:23

7 248 0
Báo cáo y học: "Mechanical ventilation using non-injurious ventilation settings causes lung injury in the absence of pre-existing lung injury in healthy mice" pdf

Báo cáo y học: "Mechanical ventilation using non-injurious ventilation settings causes lung injury in the absence of pre-existing lung injury in healthy mice" pdf

... [7,37] These results are in line with results from the present study Of note, use of LVT also resulted in profound procoagulant changes, underlining the fact that even a lung protective MV strategy ... even the use of LVT could be considered to be potentially harmful, at least in a murine setting In disagreement with some reports that did not show any effect of larger VTin patients with non-injured ... end-expiratory pressure (PEEP) was set at cmH2O with both MV strategies The fraction of inspired oxygen was kept at 0.5 throughout the experiment The inspiration to expiration ratio was kept at 1:1 throughout...

Ngày tải lên: 13/08/2014, 11:23

11 463 0
Securities Trading in the Absence of Dealers:Trades, and Quotes on the Tokyo Stock Exchange

Securities Trading in the Absence of Dealers:Trades, and Quotes on the Tokyo Stock Exchange

... current available information A further distinction between the two exchanges lies in the time needed to complete the transition On the TSE, adjustment of the quotes may necessitate intervals of ... 15-minute intervals throughout the trading day The mean squared return and spread tend to be elevated at the beginning and end of the trading day The volume tends to be elevated at the beginning ... of the trade, thereby resetting the value of the holdings (for financial reporting purposes) to current market value The TSE is also distinctive in the level of information permitted to the various...

Ngày tải lên: 31/10/2014, 12:51

30 303 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

... (15%) of tetramer +CD8+ cells was detected in the lungs after IN infection with VV-M2 Interestingly, despite the lack of VV-M2 replication in the lungs after ID inoculation, a high level (21%) of tetramer +CD8+ ... it is not the virus bearing the epitope nor local virus replication that results in the decreased functionality of CD8+ CTL in lungs, but rather the pulmonary site of residence of the cells Therefore, ... viral titers in the tissue were determined by plaque titration of lung homogenates In animals infected by the IN route, the following titers (log10 PFU per g of lung tissue) were detected in the two...

Ngày tải lên: 20/06/2014, 01:20

8 381 0
Xem thêm
w