cd8 t cell function and dysfunction during chronic hiv infection

... clinical situation First, beads and anti-CD3 have quite different effects in restimulating CD8 T cells AICD, mediated at least in part through Fas/FasL interaction and activation of the proapoptotic ... interrelationship between the type and timing of the second stimulus and expansion of restimulated CD4 (A and B) and CD8 (C and D) T cells To normalize for the impact of persistent growth attributable ... express not only the CD28 ligands CD80 and CD86 , but CD137L which can activate CD137 [18], another potent costimulatory molecule for CD8 T cell expansion [29] After interaction with stimulated T cells,...

Ngày tải lên: 18/06/2014, 16:20

... active antiretroviral therapy results in a decrease in CD8+ T cell activation and preferential reconstitution of the peripheral CD4+ T cell population with memory rather than naive cells Antiviral ... et al.: Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART AIDS Research and Therapy 2011 8:15 Submit your next manuscript to BioMed Central ... conceived the study and participated in the data analysis HW supervised and coordinated the study All authors have read and approved the final manuscript Competing interests The authors declare that they...

Ngày tải lên: 10/08/2014, 05:22

... help prevented the proper maturation and subsequent functioning of the CD8 T- cells Clearly, these Background studies support the necessity of a functional and coordinated CD8 and CD4 T cell response ... surprisingly, the little stimulatory efficiency of HLA-A203+ targets was completely lost after the 12 h dissociation period (Figure 7) It is interesting to note that the peptide presentation data recapitulate ... circularity and density distribution to identify and separate touching and overlapping spots Objects that meet these criteria are recognized as spots and counted The measurement of mean spot size...

Ngày tải lên: 10/09/2015, 08:26

... [69] Additionally, the T cells found in the blood, whether it be in their repertoire, function and state of activation, may not accurately reflect the status and behavior of their counterparts localized ... response to the treatment, and that this effect seems to be increased with prolonged time of treatment [66] Of note is the fact that this effect correlates with a medically positive outcome, i.e ... IL-17, and contribute to the onset of T1 D [53] These results suggest that an IL-2 functional deficiency in the target organ may disturb the positive feedback loop that controls Foxp3 stability,...

Ngày tải lên: 18/06/2014, 16:20

... selection of vectors is such that it would not result in a deleterious anti-vector immunity The priming strategy could then be matched with heterologous vectors that expand and/ or differentiate the ... in calves Protective immunity against SHIV in primates Protective immunity against SHIV in primates Protective immunity against SHIV in primates Protective Th1 immunity in a mouse tumor model ... Proliferation during antigen-recall Treatment with ctrl Ig Treatment with PD-1-blocking Ig DNA (Plasmid) Peptide without CpG adjuvant Figure The responsiveness of CD8+ T cells is “imprinted” during the...

Ngày tải lên: 18/06/2014, 16:20

... compartment, which is the primary contributor to TCR diversity, was affected in addition to the memory T cells Contraction of diversity in the naive T- cell compartment could not be attributed to ... anergic and prone to apoptosis; however, the opposite is the case These cells are very potent effector cells, and at least CD4+CD28null T cells are resistant to apoptosis (the data on CD8+ T cells ... demonstrated the presence of these cells in the synovial tissue of patients with RA, again postulating that the gain in cytotoxic function is of functional importance in maintaining chronic synovitis...

Ngày tải lên: 09/08/2014, 01:23

... muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8 PSMB2 NM_002794.3 proteasome subunit, beta type, PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga ... V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 Wu et al Retrovirology ... killer cell lectin-like receptor subfamily D, member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt...

Ngày tải lên: 13/08/2014, 01:20

... autologous CD4+ and CD8+ T cells were stimulated with the targeted DCs, the Wang et al Genetic Vaccines and Therapy 2010, 8:2 http://www.gvt-journal.com/content/8/1/2 Page of proliferation and cytokine ... significantly prevented by the vaccination with OVA-Fc-pcDNA3.1 Our pilot study showed that targeted DCs stimulated the proliferation of peripheral CD4+ T and CD8+ T cells in a concentration-dependent ... Biotec) and CD4+CD25 +T cells were positively and negatively selected Separation was controlled by FCM and Spleen CD4+ T cells were labeled with Mouse Regulatory T cell Staining Kit to detect the...

Ngày tải lên: 14/08/2014, 19:22

... http://www.translational-medicine.com/content/6/1/56 Competing interests The authors declare that they have no competing interests Authors' contributions YY performed protein and AAV generation and all PCR experiments and drafted the ... revised and drafted the manuscript MC participated in study design and coordination and revised and drafted the manuscript AM participated in the design of the study and revised and drafted the manuscript ... manuscript IDD participated in the design of the study and revised and drafted the manuscript WMK participated in study design and coordination and revised and drafted the manuscript EC participated...

Ngày tải lên: 18/06/2014, 15:20

... define CD8 + T cell differentiation, and might shed light on the relationship between differentiation and functional properties In that respect, it might therefore be helpful to elaborate better ... human CD8+ T cell clones and in mouse models to better understand the functional relevance of the results presented here Understanding this novel aspect of lymphocyte biology will help to better ... 1) Altogether, the data presented here demonstrate for the first time that human CD8+ T cell subsets express a Salaun et al Journal of Translational Medicine 2011, 9:44 http://www.translational-medicine.com/content/9/1/44...

Ngày tải lên: 18/06/2014, 19:20

... rather the pulmonary site of residence of the cells Therefore, the conclusion that RSV infection specifically impairs CD8+ CTL functionality [1], and the hypothesis that this might contribute to ... Days after primary (secondary) infection Lung Tet +CD8+ /total CD8+ , % Spleen IFNγ +CD8+ /total CD8+ , % Tet +CD8+ /total CD8+ , % IFNγ +CD8+ /total CD8+ , % Primary Infectiona Mockb (N = 2) RSVb (N = 5) ... percentage of total PMC or SMC (not shown) These findings are consistent with a recent study demonstrating that, after a highly localized infection with VV by tail scarification, part of the activated...

Ngày tải lên: 20/06/2014, 01:20

... define CD8 + T cell differentiation, and might shed light on the relationship between differentiation and functional properties In that respect, it might therefore be helpful to elaborate better ... human CD8+ T cell clones and in mouse models to better understand the functional relevance of the results presented here Understanding this novel aspect of lymphocyte biology will help to better ... 1) Altogether, the data presented here demonstrate for the first time that human CD8+ T cell subsets express a Salaun et al Journal of Translational Medicine 2011, 9:44 http://www.translational-medicine.com/content/9/1/44...

Ngày tải lên: 20/06/2014, 03:20

... differentiation factor 88 (MyD88) in the development of arthritis have been demonstrated in various models [18-22] The data that the injection of TLR3 and TLR9 ligands into the joints induced arthritis ... experiment, the suppressive function of RP105-/- Tregs was impaired when the cells were stimulated with collagen, but not with anti-CD3 antibody These data suggest that reduced Treg function is not ... is not known Our data suggest that a potential regulatory mechanism exists in the TLR-TLR ligand system in inflammation Conclusions Our study demonstrated that RP105 regulated the cell- mediated...

Ngày tải lên: 09/08/2014, 13:22

... MTX or anti-TNF treatment Forty patients (21 SpA and 19 RA) received anti-TNF drugs All RA patients and 10/21 SpA patients had anti-TNF + MTX Twenty-two MTX naive RA patients received MTX EBV viral ... investigate a potential EBV reactivation during MTX and/ or TNFα antagonist therapy as a possible first step of lymphoma induction During primary EBV infection, specific cytotoxic CD8+ T cells expand ... both patients, an EBV-specific T- cell response to latent peptides was detectable at baseline but was not detectable at week 12 Nevertheless, the response to lytic peptides was persistent in both...

Ngày tải lên: 09/08/2014, 14:21

... evaluation equivalent to the measurement of the total IFN-γ producing T- cells with the relevant advantage of a consistent decrease of the background that in turn increases the sensitivity of the ... ELISPOT was missed in our ICS determination By determination of the total IFN-γ+ cells, we were able to detect positive responses that were missed by the ELIPOT, but the ELISPOT was able to detect ... http://www.aidsrestherapy.com/content/5/1/22 CD8 T- cells The assay has the capacity to detect the cytokines IFN-γ and IL-2, the chemokine MIP-1β and the activation marker CD154 For the characterization of the memory phenotype, we...

Ngày tải lên: 10/08/2014, 05:21

... evaluation and to analysis of T- cell proliferation PM contributed to the design of the study and to manuscript preparation All authors contributed to interpretation of the data All authors read and ... reported that intravenous administration of the immortalized MSC cell line C3H1 0T1 /2 to immunized mice had no effect on the development of CIA [26] The treatment protocols and results of these studies ... groups at day 35 fArthritic scores were not significantly different between control treatment and treatment with wild-type or IFN-gR KO DBA/1 MSCs or C57BL/6 MSCs or with Treg cells SEM, standard...

Ngày tải lên: 12/08/2014, 11:23

... Treg phenotype to conventional T cells, allowing these Tregs to be used therapeutically for the prevention of autoimmunity and transplant rejection Several groups have investigated the potential ... normal T- cell contraction (Figure 4) Overall, these data strongly support the conclusion that the combined activities of FoxP3 and BclxL promote both the differentiation and long-term survival of Tregs ... shown that adoptive cell transfer of Tregs can suppress arthritis [24,32] Therefore, we tested the hypothesis that co-transduction of CD4+ T cells with both FoxP3 and BclxL will generate highly...

Ngày tải lên: 12/08/2014, 12:20

... blocking activities than RMT2-14 Anti-TIM-2 mAb treatment exacerbates CIA To explore the contribution of TIM-2 to the development of autoimmune arthritis, we first administrated anti-TIM-2 mAb (RMT2-14) ... treatment (P>0.05 at every concentration of dCII) IL-4 and IL-5 were measured but not detectable (data not shown) Taken together, these results suggest that the anti-TIM2 mAbs treatment not affect ... CD4 T cells and the anti-TIM-2 mAb treatment did not affect Th1 and Th17 responses, suggesting that TIM-2 addition of RMT2-14 and RMT2-25 significantly enhanced the proliferation [See Additional...

Ngày tải lên: 12/08/2014, 15:22

... experimental infection We show that recent and chronic infections protect infected CD8+ cells from cell death while producing significantly distinct effects on the cell cycle of CD4+ and CD8+ clones, ... infected CD4 + and CD8 + cells Regarding the cell cycle, the known HTLV-1-dependent recruitment of infected CD4 + cells into the cell cycle [8] appears restricted to the persistent infection ... vivo infected cells, meaning that it has been selected during persistent infection Hitherto, two factors have been considered to rule HTLV-1 replication and pathogenicity: the effects of HTLV-1 encoded...

Ngày tải lên: 12/08/2014, 23:23

Ngày tải lên: 13/08/2014, 01:20