cd8 t cell epitopes against mycobacterium tuberculosis

... into DCs could elicit a significant CTL response against IE1-positive target cell lines This was the first time that the gene encoding IE1 was inserted into the AAV vector First, the IE1 gene was ... Acknowledgements This project was supported by the Institutional Research Program of the Texas Tech University Health Sciences Center, the Southwest Cancer Treatment and Research Center Program, the Laura ... stimulated AAV/IE1-specific CTLs We analyzed the ability of the AAV/IE1 vectors to generate IE1 specific-CTLs (optimal ratio E :T; 1:20) To analyze CTL activity, we used the following target cell...

Ngày tải lên: 18/06/2014, 15:20

... differentiated effector T cells, but unlike conventional effectors [22], the CD45RA+ CD8 T cells noted after anti-CD3 treatment were consistently CD27+ (Figure 3) and CD57- (data not shown) Effector ... matched control cells also often expanded as well To distinguish true restimulation-dependent growth from persistent expansion still attributable to primary stimulation, we calculated the ratio ... stimulated cells/expansion by matched control cells and plotted this as a function of the time interval between first and second stimulation (Figure 8A-D) These plots make two important points...

Ngày tải lên: 18/06/2014, 16:20

... deleterious anti-vector immunity The priming strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically useful effector T cells ... Induction of robust CTL immunity in mouse Immunity against Hsp67, 70, Apa in calves Protective immunity against SHIV in primates Protective immunity against SHIV in primates Protective immunity against ... antigen exposure and other factors •Limited antigen exposure, with potent co-stimulation could lead to T cells that retain low PD-1 expression through various stages: recently activated, effector...

Ngày tải lên: 18/06/2014, 16:20

... regulated concomitantly, indicating a differential intra-cluster regulation in agreement with the TLDA results (Table 1) Altogether, the data presented here demonstrate for the first time that human ... properties In that respect, it might therefore be helpful to elaborate better vaccination strategies for induction of CD8 + T cells with appropriate differentiation and functions Acknowledgements The ... role in CD8+ T cells remains an interesting issue to investigate, as it might shed new light on the relationship between cytokine signaling and lymphocytes differentiation In contrast to the clear...

Ngày tải lên: 18/06/2014, 19:20

... tetramer +CD8+ T cell response (23% of total CD8+ cells) was detected in the lungs (Table 1) A somewhat lower response (15%) of tetramer +CD8+ cells was detected in the lungs after IN infection with ... residence of the cells Therefore, the conclusion that RSV infection specifically impairs CD8+ CTL functionality [1], and the hypothesis that this might contribute to RSV re-infection, must be reassessed ... replication in the lung Thus, it is not the virus bearing the epitope nor local virus replication that results in the decreased functionality of CD8+ CTL in lungs, but rather the pulmonary site of...

Ngày tải lên: 20/06/2014, 01:20

... regulated concomitantly, indicating a differential intra-cluster regulation in agreement with the TLDA results (Table 1) Altogether, the data presented here demonstrate for the first time that human ... properties In that respect, it might therefore be helpful to elaborate better vaccination strategies for induction of CD8 + T cells with appropriate differentiation and functions Acknowledgements The ... role in CD8+ T cells remains an interesting issue to investigate, as it might shed new light on the relationship between cytokine signaling and lymphocytes differentiation In contrast to the clear...

Ngày tải lên: 20/06/2014, 03:20

... evaluation equivalent to the measurement of the total IFN-γ producing T- cells with the relevant advantage of a consistent decrease of the background that in turn increases the sensitivity of the ... ELISPOT was missed in our ICS determination By determination of the total IFN-γ+ cells, we were able to detect positive responses that were missed by the ELIPOT, but the ELISPOT was able to detect ... 0.05 for all statistical tests http://www.aidsrestherapy.com/content/5/1/22 Additional material Additional file Gating strategy Representative example showing the gating strategy of the colour ICS...

Ngày tải lên: 10/08/2014, 05:21

... predict antiretroviral therapy (ART) treatment failure [21,22] Several studies [23-25] showed activated CD8+ T cells decreased after ART But they did not reveal the change of activated CD8+ cell ... However, little is known about the change of CD8+ cell subsets during early period of ART In this study we investigated the dynamic changes not only in CD8+ cell subsets, but also in their activation ... after ART Activation of CD8+ cell subsets We next investigated the effect of ART on T cell activation HIV-infected individuals had higher T- cell activation in the blood as indicated by expression...

Ngày tải lên: 10/08/2014, 05:22

... addition to the TLR agonists that are innate immunity ligands, the immune response involves two adaptive immunity ligands that are expressed on activated T cells and bind to non-TLR receptors ... that, even at this early time point, both IMP321 recipients who had seroconverted after the second immunization in the μg group had attained seroprotective titers Following the third immunization, ... stimulation with two HLA-A2-restricted peptides After amplification of the specific T cells with the peptides, the number of CD8+ T cells bearing a TCR recognizing one of these two peptides presented on...

Ngày tải lên: 11/08/2014, 10:23

... muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt VIRvsLTNP CD8 4.3 2.8 PSMB2 NM_002794.3 proteasome subunit, beta type, PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga ... V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 Wu et al Retrovirology ... killer cell lectin-like receptor subfamily D, member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt...

Ngày tải lên: 13/08/2014, 01:20

... RPQVPLRPMTY RPQVPLRPMTY d415 RPQVPLRPMTY HLA-A2 YTAFTIPSI (RT 71-81) 127-135) YTAFTIPSI YTAFTIPSI /T YTAFTIPST YTAFTIPST 127-135) d28 YTAFTIPSV d53 YTAFTIPSV d81 YTAFTIPSV d299 YTAFTIPSV/I d9 AAVDLSHFLK ... of these cases it appeared that an escape mutation had been transmitted that then reverted, stimulating expansion of T cells able to recognise the original epitope with higher avidity than the ... concentration Turnbull et al Retrovirology 2011, 8:41 http://www.retrovirology.com/content/8/1/41 studied had avidity values within the μM to nM range at the earliest time-point tested When the relative...

Ngày tải lên: 13/08/2014, 01:20

... to wild type TW10 peptide, but not to autologous variants Representative dot plot and histogram shown for stimulation with one of the autologous mutants, TSTLTEQVAW (top left) and wild type TW10 ... infected PHA activated CD4 +T cells from ES8 with the replication competent viruses constructed to express these TW10 variants, and co-cultured the infected cells with each CD8+ T cell population that ... fitness further This may suggest that compensatory mutations exist in the plasma variants which partially rescue fitness defects caused by the TW10 mutations, but that these compensatory mutations...

Ngày tải lên: 13/08/2014, 01:21

... 5'-ggatccatgtctgataatggaccc-3'; reverse primer: 5'-gaattcttatgcctgagttgaatc-3') The amplicon was purified using the QIAquick gel extraction kit (Qiagen) and cloned into the PCR 2.1 TOPO-TA vector ... neither the mock-transfected cells nor the cells transfected with the vector alone showed viral-like particles (Fig 2) These observations demonstrate that our construct expressing the NC protein ... protein synthesised sufficient protein within infected cells to facilitate the formation of VLPs Detection of antibody titer in mice immunized with the candidate vaccine combinations In order to analyze...

Ngày tải lên: 14/08/2014, 19:22

... longer than those infected with the bacille Calmette-Guerin11 Pasteur (BCG-P) strain Deletion of the genes significantly attenuates Mtb and protects infected animals against tuberculosis In an attempt ... in the treatment of tuberculosis will require us to identify new targets in pathways critical for the sustenance of Mtb, and to develop new drugs selectively inhibiting these targets so as to ... failure rate and cost of treatment (Glynn et al., 2002; Reece and Kaufmann, 2008) This has prompted further interest in the development of more effective TB treatment strategies 1.5 L-ASPARTATE α-DECARBOXYLASE...

Ngày tải lên: 09/09/2015, 17:53

... surprisingly, the little stimulatory efficiency of HLA-A203+ targets was completely lost after the 12 h dissociation period (Figure 7) It is interesting to note that the peptide presentation data recapitulate ... multi-specific CD8 T- cells with the absence of CD4 T- cells 38 This suggests that the absence of CD4 cytokine help prevented the proper maturation and subsequent functioning of the CD8 T- cells ... subtypes 59 Furthermore, the ability of HLA-A2 subtypes to preferentially present different sets of peptides 68, 69 is another important contributor of the distinct epitopes targeted in HBV patients...

Ngày tải lên: 10/09/2015, 08:26

... HA is a lectin that mediates the binding of the virus to target cells and facilitates the entry of the virus into the target cell The proteolytic cleavage of the HA molecule (HA0) into HA1 and ... infection is to provide T cell help to augment B cell antibody production and CD8+ T cell cytolysis of infected cells to clear the virus from the respiratory tract Different subsets of Th cells ... CD8+ T cells rather than their proliferation may be attributed to IL-7 IL-15 on the other hand is a more potent proliferative agent for memory CD8+ T cells This is supported by the fact that IL-15-...

Ngày tải lên: 10/09/2015, 09:25

... I that makes them targets for 18 Chapter 1: Introduction recognition and susceptibile to killing by CD8 T cells CD8 T cells are crucial for the elimination of infected and tumor cells CD8 T cells ... cells start off as naïve T cells that circulate the body after development in the thymus CD8 T cells are activated by encounter with antigen, which results in their proliferation and differentiation ... Memory CD8 T cells are thought to develop from the effector cell pool and are important for protection against recurrent infection by intracellular pathogens 19 Chapter 1: Introduction Dendritic cells...

Ngày tải lên: 11/09/2015, 09:11

... therapy (table 3) INH-treated subjects The IFN-gamma response to PPD, QTF-G, RD1 intact proteins and selected peptides of the 24 TST+ individuals that started therapy, and that did not report ... than the polyclonal one against all RD1 epitopes It is also important to note that among all these recent contacts nine did not respond at the first time of observation to RD1 selected peptides ... subjects in whom a cuticonversion was not observed (data not shown) It is interesting to note that in the group of the individuals that reported an exposure to MTB in the past and started INH therapy...

Ngày tải lên: 12/08/2014, 15:20

... anti-sense TTG GAA TGC AGA CAC CAC CT; T- bet sense CCC CTG TCC AGT CAG TAA CTT; T- bet anti-sense CTT CTC TGT TTG GCT GGC T; Foxp3 sense ACA ACC TGA GCC TGC ACA AGT; Foxp3 anti-sense GCC CAC CTT ... integrity samples control and primers sequences were: b-actina sense AGC TGC GTT TTA CAC CCT TT; bactina anti-sense AAG CCA TGC CAA TGT TGT CT; GATA-3 sense AGG AGT CTC CAA GTG TGC GAA; GATA-3 ... assays not only show that B cells were able to act as APC but also that they had capacity to activate CD8 T lymphocytes and promote the generation of memory CD8 T cells These in vivo results are...

Ngày tải lên: 14/08/2014, 19:22

... TGAGCCCCCGAGTTGG-3¢), CC62 (5¢-GTGTTGCGG TGAATGTGCTCAAGAGCG-3¢) and two reverse primers, CC61 (5¢-CTGCCCGGTGGGGGTGATCAAGA TG-3¢), CC63 (5¢-CGCTCTTGAGCACATTCACCGCA ACAC-3¢), were synthesized Base mismatches ... orientation, pPknA was initially digested with NdeI and treated with Klenow to obtain a blunt-ended fragment After restriction digestion with BamHI, this fragment was subsequently ligated to p19Kpro, ... shape regulation; it is the first report describing the functionality of any eukaryotic-type Ser/Thr kinase from M tuberculosis Identification of the natural substrate of PknA in mycobacteria would...

Ngày tải lên: 22/02/2014, 04:20